0
What else can I help you with?
Related Questions
When was Carl Eggers born?
Carl Eggers was born in 1787.
When was Melvin A. Eggers born?
Melvin A. Eggers was born in 1916.
When was Graydon Eggers born?
Graydon Eggers was born in 1903.
When was Bill Eggers born?
Bill Eggers was born on 1932-12-27.
When was Dave Eggers born?
Dave Eggers was born on March 12, 1970.
When was Jörg A. Eggers born?
Jörg A. Eggers was born on 1936-06-15.
When was Adolph Julius Eggers born?
Adolph Julius Eggers was born in 1859.
When was Alan Louis Eggers born?
Alan Louis Eggers was born on 1895-11-02.
When was Frank H. Eggers born?
Frank H. Eggers was born on 1901-02-22.
When was Alfred J. Eggers born?
Alfred J. Eggers was born on 1922-06-24.
When was William D. Eggers born?
William D. Eggers was born on 1967-02-14.
When was Harald Eggers born?
Harald Eggers was born on June 2, 1927, in Hamburg, Germany.
Trending Questions
What did the 101st airborne division do to stop the German army during the the battle of Bulge?
On a two way highway you are allowed to drive on the left half of the roadway when?
When was Alan Ferguson born?
How many hours is a flight by plane from Mexico to South Africa?
How many miles is it from Coppell TX to Austin TX?
What are some popular recipes that incorporate Italian hot sauce as a key ingredient?
What does the phrase a stich in time saves 9?
What is is the grandfathers name on rugrats?
What is the zip code of kalamoun tripoli Lebanon?
Will there be a catwoman 2?
Was Harry Houdini Sterile?
What are the major theories of first language acquisition?
What is a 7 sided polygon with one interior right angle?
Interview questions to a teacher about bilingual education?
Where does Curtis Granderson Live?
Which earth motion causes the apparent daily movement of the constellations?
What is the difference between being possessive and being protective?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What is radifiction?
How do you check your payment on your foremost policy?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.