0
What else can I help you with?
Related Questions
How old is Rivers Cuomo?
Rivers Cuomo is 47 years old (birthdate: June 13, 1970).
What band is Rivers Cuomo from?
Rivers Cuomo is the lead singer of Weezer.
What nicknames does Rivers Cuomo go by?
Rivers Cuomo goes by Ace, Varz, and Weezer.
When did rivers cuomo get married?
Rivers Cuomo of Weezer married Kyoko Ito on June 18, 2006. The two had known each other since March 1997.
When was Gennaro A. Cuomo born?
Gennaro A. Cuomo was born in 1962.
When was Franco Cuomo born?
Franco Cuomo was born in 1938.
When was Luigi Cuomo born?
Luigi Cuomo was born in 1905.
Who sings high maintenance with Miranda Cosgrove?
Rivers Cuomo
When was Chris Cuomo born?
Chris Cuomo was born on August 9, 1970
When was Donna Cuomo born?
Donna Cuomo was born on 1947-03-19.
When was George Michael Cuomo born?
George Michael Cuomo was born in 1929.
When was Sandro Cuomo born?
Sandro Cuomo was born on 1962-10-21.
Trending Questions
Should juveniles being tried as adults?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The point where two air masses meet is called a?
How do you get seaman's book what are the requirements?
How did science and technology lead to the growth of Mayan influence?
What is 10 million divide by 9.856?
From where is Vanessa Hudgens mother?
How can you find garibaldi fish?
What is the time to turn a distance of 1 degree?
When was theora stephens born?
Which continent are the himalaya mountains located?
Where do you often find an adjective?
Did Hernando De Soto ever go to school?
Is Hansel and Gretel American literature?
Did Kristinia Debarge go to South Pasadena High School or was she homeschooled?
Is 3 days enough to have a opiate free urine sample?
What do the doctors say about marijuana in your system?
Is regardless a verb?
ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this?
What was The French courtly love song of the Middle Ages called?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.