answersLogoWhite

0

When was Robert Ingersoll Aitken born?

User Avatar

Anonymous

∙ 12y ago
Updated: 8/21/2019

Robert Ingersoll Aitken was born on 1878-05-08.

User Avatar

Wiki User

∙ 12y ago
Copy

What else can I help you with?

Related Questions

When did Robert Ingersoll Aitken die?

Robert Ingersoll Aitken died on 1949-01-03.


When was Robert S. Ingersoll born?

Robert S. Ingersoll was born in 1914.


When was Robert P. Aitken born?

Robert P. Aitken was born in 1819.


When was Robert G. Ingersoll born?

Robert G. Ingersoll was born on August 11, 1833.


When was Robert Hope Moncrieff Aitken born?

Robert Hope Moncrieff Aitken was born in 1828.


When was Robert Grant Aitken born?

Robert Grant Aitken was born on 1864-12-31.


When was Robert Baker Aitken born?

Robert Baker Aitken was born on 1917-06-19.


When was Robert Aitken - composer - born?

Robert Aitken - composer - was born on 1939-08-28.


What is Robert G. Ingersoll's birthday?

Robert G. Ingersoll was born on August 11, 1833.


When was Robert Ingersoll Birthplace created?

Robert Ingersoll Birthplace was created in 1833.


When did Robert S. Ingersoll die?

Robert S. Ingersoll died in 2010.


How old is Robert G. Ingersoll?

Robert G. Ingersoll was born on August 11, 1833 and died on July 21, 1899. Robert G. Ingersoll would have been 65 years old at the time of death or 181 years old today.

Trending Questions
What is 27 MHz to AWG wire conversion? Why do you need to segregate your garbage? Do only businesses need a ferderal tax id number? Why was a knock on the door considered to be scary during the great purge? How do you install a generic cigarette lighter in a 1990 Toyota pickup that didn't come with one? What are the arts in visayas? Would meteorologists frequently study viruses? What did carpet baggers do? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? What did John Brown attack in Virginia? Why does your window air conditioner smell like fish? How made aveeno? Acute angles measure what? What is the smallest planet on solar system sleuthing? What weighs more a pound of feathers ora pound of lead? Where did Martin Frobisher die? What is 0.583 rounded to the nearest tenth? Who wrote the Jack and Jill nursery rhyme? What does kilovoltage control? How far is Detroit Michigan from Sydney Australia?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.