0
What else can I help you with?
Related Questions
When was Stevica Kuzmanovski born?
Stevica Kuzmanovski was born on 1962-11-16.
When was Slobodan Šijan born?
Slobodan Šijan was born in 1946.
When was Slobodan Matijevic born?
Slobodan Matijevic was born in 1988.
When was Slobodan Šiljak born?
Slobodan Šiljak was born in 1881.
When was Slobodan Ninković born?
Slobodan Ninković was born in 1956.
When was Slobodan Pejić born?
Slobodan Pejić was born in 1944.
When was Slobodan Kovač born?
Slobodan Kovač was born in 1967.
When was Slobodan Mišković born?
Slobodan Mišković was born in 1944.
When was Slobodan Lalović born?
Slobodan Lalović was born in 1954.
When was Slobodan Branković born?
Slobodan Branković was born in 1967.
When was Slobodan Backović born?
Slobodan Backović was born in 1946.
When was Slobodan Kovačević born?
Slobodan Kovačević was born in 1946.
Trending Questions
What layer of the earth that Metal of this region are squeezed tight due to great pressure?
What term describe people leaving farm to live and work in city?
What is surface complexation?
Who were melchior and casper?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How many 150 ml glasses in 4 litres of water?
Can you provide examples of IOUs and explain how they are typically used in financial transactions?
What was the most powerful ancient country?
What happens at the end of the book Scat?
What is the quotient of 4 and 82?
What are the most effective exercises to target the abs using an exercise ball?
Where did the plague begin and how was the plague spread from place to place?
Did Bruce Lee fight a demon?
How tall is Nunziatina Vitanza?
Does sterling knight kissed Selena Gomez?
What actors and actresses appeared in Obake no Q-taro - 1965?
How can you remove scale floating around and blocking your faucets?
Which is true about the effect farming has on erosion?
When was Grant Ibbs born?
What not to mix with anitripyline?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.