0
What else can I help you with?
Related Questions
When was Manzano Mountains State Park created?
Manzano Mountains State Park was created in 1973.
When was Davis Mountains State Park created?
Davis Mountains State Park was created in 1938.
When was Franklin Mountains State Park created?
Franklin Mountains State Park was created in 1979.
When was South Higgins Lake State Park created?
South Higgins Lake State Park was created in 1927.
When was South Toledo Bend State Park created?
South Toledo Bend State Park was created on 2004-11-20.
When was Bale Mountains National Park created?
Bale Mountains National Park was created in 1970.
When was Hartz Mountains National Park created?
Hartz Mountains National Park was created in 1939.
When was Caribou Mountains Wildland Park created?
Caribou Mountains Wildland Park was created in 2001.
When was Rwenzori Mountains National Park created?
Rwenzori Mountains National Park was created in 1991.
When was Opawskie Mountains Landscape Park created?
Opawskie Mountains Landscape Park was created in 1988.
When was Wicklow Mountains National Park created?
Wicklow Mountains National Park was created in 1991.
When was Owl Mountains Landscape Park created?
Owl Mountains Landscape Park was created in 1991.
Trending Questions
Where are all the stamps in Club Penguin?
Who won batting title as a catcher?
What city has this longitude and latitude 41s 175e?
What are the common multiples of 84 and 105?
When is 1159 CST in eastern standard time?
What are the differences in powers between lt governors?
Did Beyonce help Miley Cyrus in her video party in the usa?
What is the past tense of drawdown?
What do you need for a dog to cross the American border?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
How tall is Bobby Wagner?
Modern warfare 2 care package glitch PS3?
How do get cinnamon out of eyes?
What land did Lyndon Johnson acquire?
What day of the week was July 29 1958?
Is organize is a correct word?
How does climate affect leaf structure?
How can I identify a brown fuzzy caterpillar?
What is frequency used for?
How much do sweaters weigh?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.