answersLogoWhite

0

When was Susan Kay born?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Susan Kay was born in 1952.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

How tall is Susan Kay Thompson?

Susan Kay Thompson is 5' 8".


What is the duration of Kay Susan Tayo?

The duration of Kay Susan Tayo is 2700.0 seconds.


When was Kay Susan Tayo created?

Kay Susan Tayo was created on 2003-11-30.


What is the birth name of Susan Lovell?

Susan Lovell's birth name is Lovell, Susan Kay.


Is Peter Kay Catholic?

No, he is married to Susan Kay and has been since 2001


In the Susan Kay novel Phantom what was Erik's father's profession?

Architect


When was Kay Kay born?

Kay Kay was born on August 23, 1970, in Thrissur, Kerala, India.


How did Susan Kay Archer die?

Susan Kay Archer was walking on the shore when a unexpected wave hit them all. her boyfriend was hit by a rock so he dint go out to sea their dog swam back to shore.


When was Kay Kay Menon born?

Kay Kay Menon was born on August 23, 1964, in Kerala, India.


What has the author Susan Kay Arndt written?

Susan Kay Arndt has written: 'Adolescent alcohol consumption and a changing legal drinking age' -- subject(s): Drinking age, Alcohol use, Teenagers, Drinking of alcoholic beverages


When was Kay Kurt born?

Kay Kurt was born in 1944.


When was Kay Denman born?

Kay Denman was born in 1937.

Trending Questions
Can a parent kick you out if you are over the age of 18? What is the Gosselin family's political affiliation? How tall is Radhaa Nilia? What level does lombre learn fake out? Which of the following is NOT one of the so-called pillars of primary health care as outlined by the Declaration of Alma Ata? What are animal claws used for? What is the distance between two longitudes at the equator? Does ingrown toenail surgery hurt? When was Black dress of Rita Hayworth created? Who does Mr Pilkington represent in Animal Farm? Is the moon made out of sand? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What if caffeine does not have an effect on you? What is the definition of futile? Why is there an Australian midget pooping in your attic? How much does a cintas ssr make? Michael's Coupons? What does miogynistic mean? What are three examples of governmental actions that might interfere with free market? What are the 4 major civic duties?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.