answersLogoWhite

0

When was TV Pforzheim created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

TV Pforzheim was created in 1834.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was VfR Pforzheim created?

VfR Pforzheim was created in 1897.


When did VfR Pforzheim end?

VfR Pforzheim ended in 2010.


When did Bombing of Pforzheim in World War II happen?

Bombing of Pforzheim in World War II happened in 1945.


Where is pforzheim?

Pforzheim is a city located in southwestern Germany, situated at the confluence of the Nagold, Enz, and Würm rivers. It lies in the state of Baden-Württemberg, approximately 30 kilometers northwest of Stuttgart. Known as the "Goldstadt" (Gold City), Pforzheim has a rich history in jewelry and watchmaking. The city is also a gateway to the Black Forest region.


When was Bernd Schmidbauer born?

Bernd Schmidbauer was born on May 29, 1939, in Pforzheim, Germany.


When was Dieter Kosslick born?

Dieter Kosslick was born on May 30, 1948, in Pforzheim, Germany.


When was Emil Hoch born?

Emil Hoch was born on October 21, 1866, in Pforzheim, Germany.


When was Eva Hassencamp born?

Eva Hassencamp was born on May 24, 1920, in Pforzheim, Germany.


When was I-Television created?

I-Television was created in 1992.


When was Out There TV created?

Out There TV was created in 2001.


When was .TV created?

.tv was created in 1996.


When was WE tv created?

WE tv was created in 1997.

Trending Questions
What is 77725 rounded to the nearest hundred? List three forms of energy into which electricity energy can be changed? What is the birth name of Vadia Potenza? How do you write an absent letter to school because of music exam? How do you find frankencarot in adventurequest? What is deposit form? What is A mixture of equal amounts of two enantiomers? The Edison Electric Institute was established in what year? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? What does section 17 of the constitution say? Can you use canon power shot a 495 as webcam? How do I join delta sigma theta in Hampton? Imagine of oil supplies get exhausted have will affect your lifestyle? What is another word for most recent? What is Wales currency? What is 95 in hiragana? Does Ichiban Ushiro no Daimaou have nudity? What is the family for which AT89S52 belongs to? What did Georgia have more of than other states in World War 1? How can I safely and effectively remove popcorn ceilings through scraping?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.