0
What else can I help you with?
Related Questions
When did Thomas Saunders Gholson die?
Thomas Saunders Gholson died in 1868.
When was Thomas A. Saunders III born?
Thomas A. Saunders III was born in 1937.
When was Thomas William Saunders born?
Thomas William Saunders was born in 1814.
When was Thomas Harry Saunders born?
Thomas Harry Saunders was born in 1813.
When was James Gholson born?
James Gholson was born in 1798.
When was William Y. Gholson born?
William Y. Gholson was born in 1807.
When was Jeb Gholson born?
Jeb Gholson was born on March 31, 1934, in Ohio, USA.
When was Samuel J. Gholson born?
Samuel J. Gholson was born on 1808-05-19.
When was Richard D. Gholson born?
Richard D. Gholson was born on 1804-01-31.
When was John Gholson born?
John Gholson was born on September 23, 1975, in Houston, Texas, USA.
When was Julie Gholson born?
Julie Gholson was born on June 4, 1958, in Birmingham, Alabama, USA.
When did Thomas William Saunders die?
Thomas William Saunders died in 1890.
Trending Questions
What movie and television projects has David Agranov been in?
What would you do if you didn't know who to chose to be your best friend?
What is the percent intercept in linear regression and how is it calculated?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What is 71 and 3 over 8 rounded to the nearest tenth?
Where can I watch Kodomo no Omocha no downloads?
How many weeks are there in 6 years?
What were some differences between the major and independent labels both in how they operated and in what kind of music they specialized in?
Which Bollywood producer did Sridevi marry in 1996?
What are some inresting facts about Ann Gloag?
What is 2.934 rounded to nearest thousands?
Can you put bowling ball in sun to draw out oil?
Does vans put on griptape?
What do hydrologists, who study water and the water cycle, specialize in?
What is usually the portion of fungus that you see above the ground?
What was the name of the band formed by the daughters of the Beverley Sisters?
What should i do if i Dropped a battery down shower drain?
Why was battle of panipat important?
What is Pteridophytes?
Who is lil scrappy baby mama?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.