0
What else can I help you with?
Related Questions
When was William J. Whalen III born?
William J. Whalen III was born on 1940-07-18.
When did William J. Whalen III die?
William J. Whalen III died on 2006-09-28.
When was James J. Whalen born?
James J. Whalen was born in 1927.
When did James J. Whalen die?
James J. Whalen died in 2001.
When did Thomas Whaley die?
Thomas Michael Whalen III died in 2002.
When was William J. J. Gordon born?
William J. J. Gordon was born in 1919.
When was William J. White born?
William J. White was born on 1850-10-07.
When was Laurence Whalen born?
Laurence Whalen was born in 1944.
When was Joe Whalen born?
Joe Whalen was born in 1916.
When was Walter Whalen born?
Walter Whalen was born in 1898.
When was William J. Calhoun born?
William J. Calhoun was born in 1848.
When was William J. Mitsch born?
William J. Mitsch was born in 1947.
Trending Questions
What is William Christopher of the MASH series doing today?
How old was hanson when they first became famous?
Is NAFTA an agreement created by the US Mexico and Japan?
What stores that carry Angel perfume for refill?
How often do you need to change the battery?
What happened in the world during 1869-1877?
How do you clear engine codes?
Did Maya Moore retire?
Which states were involved in heavy fighting between 1776 and 1778?
A word which has 3 consecutive letters?
How much is 1847 seated liberty dollar worth per coin?
How can an equation represent a shape?
What point does Anthony make by comparing these two quotes?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
Should I wedgie my little cousin because she's a cheerleader if so how?
If you had a brand new car repossessed last year and it was sold at auction for 10K and you had a 28K loan can you get out of the 18K you still owe if your credit was perfect?
Is it require to file gift tax return with IRS for a retained life estate deed?
How does variation help or hurt an organism?
How many bags of coleslaw for 50 people?
What is the value of a 1939 Canadian silver dollar George sixth parliament buildings on obverse?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.