answersLogoWhite

0

When was Zhejiang Sci-Tech University created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Zhejiang Sci-Tech University was created in 1897.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was Zhejiang University created?

Zhejiang University was created in 1897.


When was Zhejiang Forestry University created?

Zhejiang Forestry University was created in 1958.


When was Zhejiang Medical University created?

Zhejiang Medical University was created in 1952.


When was Zhejiang Gongshang University created?

Zhejiang Gongshang University was created in 1911.


When was Zhejiang University of Technology created?

Zhejiang University of Technology was created in 1953.


When was Zhejiang Normal University created?

Zhejiang Normal University was created in 1956.


When was Zhejiang Ocean University created?

Zhejiang Ocean University was created in 1988.


When was Zhejiang Chinese Medical University created?

Zhejiang Chinese Medical University was created in 1953.


When was Zhejiang University Libraries System created?

Zhejiang University Libraries System was created in 1897.


When was Zhejiang University School of Medicine created?

Zhejiang University School of Medicine was created in 1912.


When was Scitech created?

Scitech was created in 1988.


When was SciTech Software created?

SciTech Software was created in 1996.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.