0
Miles Boykin was born on October 12, 1996
What else can I help you with?
Related Questions
When is Miles Boykin's birthday?
Miles Boykin was born on October 12, 1996
When was Otis Boykin born?
Otis Boykin was born on August 29, 1920.
When was Christopher Boykin born?
Christopher Boykin was born on 1972-01-13.
When was Burwell Boykin Lewis born?
Burwell Boykin Lewis was born in 1838.
When was Mary Boykin Chesnut born?
Mary Boykin Chesnut was born in 1823.
When was Deral Boykin born?
Deral Boykin was born on 1970-09-02.
When was Richard Boykin Kellam born?
Richard Boykin Kellam was born in 1909.
When was McKinley Boykin born?
McKinley Boykin was born on 1983-03-24.
When was Brandon Boykin born?
Brandon Boykin was born on 1990-07-13.
When was Sylvia Boykin born?
Sylvia Boykin was born on January 31, 1969, in Gainesville, Florida, USA.
When was Bob Boykin born?
Bob Boykin was born on September 24, 1952, in San Diego, California, USA.
When was Keith Boykin born?
Keith Boykin was born on August 28, 1965, in St. Louis, Missouri, USA.
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.