0
What else can I help you with?
Related Questions
Who discovered brine shrimp?
Thong discovered the brine shrimps.
What are brine shrimp classified as?
Brine Shrimp are crustaceans.
What do brine-shrimp like?
Brine-shrimp like algae and eggs Brine-shrimp like algae and eggs
What are the effects of fertilizers on brine shrimp?
it kills the brine shrimp (sea monkeys) it kills the brine shrimp (sea monkeys)
At what depth do brine shrimp live?
Brine shrimp thrive in shallow, brackish water.
Are brine shrimp freshwater?
no, as brine shrimp are saltwater animals and will not survive in freshwater.
Are seamonkeys considered brine fish?
They aren't fish. They are brine shrimp. (shrimp = invertebrates)
Is a brine shrimp a comuer decomesum or porducer?
is a brine shrimp a consumer producer decomposer
Where was the sea monkeys discovered?
They are actually a hybrid of brine shrimp created in the US in a Science lab. Have a Great day! :)
How do brine shrimp breathe?
Brine shrimp breathe through gill plates on their feet.
What are brine shrimp common name?
Their common name is Brine Shrimp. Their scientific name is Artemia
What are brine shrimps habitat?
what is the habitat of brine shrimp
Trending Questions
What is 15 billion divided by 111 million?
What is the process by which plants and other organisms use sunlight to convert carbon dioxide and water into oxygen and glucose, and what can do photosynthesis?
Should you cut back lantana plants for the winter?
What would cause my 2001 Chrysler town and country's heat-ac blower control to only work on high speed For both the front and rear controls. Could be as simple as a fuse or is it the control panel?
Was Christ born in Ethiopia?
What exercises should I do to improve my overall fitness level?
How can we promote a culture of respect and appreciation for the female body?
What rhymes with Justus?
What effects does hard dry soil have on flooding?
What does a open circle mean of line graph?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What time is it in Hawaii if it is 8 am in minnesota?
Do you take out the tampon applicator when you use a tampon?
What happens if a person becomes ruffled in a tense situation?
Words ending with the letter g?
What zone does coral live at?
What are the release dates for Silent Angels The Rett Syndrome Story - 2000 TV?
What is ncoridcoiia unscrambled in Spanish?
What is the duration of Pauly Shore Is Dead?
Are there any alternative bands with an electric violinist?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.