0
Tenochtitlan Mexicohe
What else can I help you with?
Related Questions
How old was Rames II when he reigned?
Ramses was 19
Who is Rames II?
He was a Egyptian Pharaoh and was one of the most famous
Why is Rames the 2nd called Rames the great?
Ramses II was the longest Ruling Pharaoh!!! He built more temples, monuments than any other Egyptian Pharaoh.
Where in Egypt did ramesses ii live?
Ramesses ii lived in giza, egypt
What pharaoh was in power in 1441 BC?
I would say Rames II. If this date is the date supposed to be the exodus out of Egypt by Moses then Ramses II is a logical answer.
What continent did rames 2 rule on?
Ramesses II ruled in Ancient Egypt, which spanned the continents of Africa and Asia.
Where did Pope John Paul II live and work?
Pope John Paul II lived and worked in Vatican City.
What is the ISBN of N'Heures Souris Rames?
The ISBN of N'Heures Souris Rames is 0517540819.
How did Rames III die?
Rames III was murdered by one of minor wives Tiye.
What city did king Carol of Romania live in?
Both (Carol I and Carol II) lived in Bucharest.
Where did King Rames the second rule?
I think King Rames the second ruled in Ancient Egypt!?!?!?!?!?!?!?
Who was the pharaoh after Tutankhamun?
rames I
Trending Questions
What are the organs located in hypogastric region?
Which A-level subjects do I need to take if I am are persuing a degree in mass communication?
What country invaded Korea in 1592?
What is 21 degrees and 21 mins north and 157 degrees and 57 mins west?
A White Computer Desk Can Be Calming?
What gang has a burgundy flag?
How do you say thank you so much in chuukese?
How do you round 58.635 to the nearest hundredth?
Can lifting weights cause constipation?
What are the differences between responses of mammals and flowering plants?
What is the area of the excel window in which you enter and edit data?
Did descartes believe in the very powerful evil demon?
Where do you get a diamond armlet?
How far is it from Greenville SC to Cocoa Beach FL?
What is an graphical operating system?
What is a fem agress?
Can a self cleaning oven be stopped before it's done?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What did Joe Frazier do?
What rhymes with calories?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.