answersLogoWhite

0

Where do African ants live?

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

in the ground

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

Where thief ants live?

where do thief ants live


Do antelope live in an African savanna?

Yes Africa has many types of antelope that will live in the savannah


Which ants live in a tent?

humanoid ants live in tents because its nice and cozy!


What do ants live in?

ants live in Sand and bird nest.


What is the name of African ants?

snafu's


What do ants live in best?

A colony isn't that where all the ants live


Do porcupine eat ants?

If ants are insects, then yes, they do eat ants. Well, since the African porcupine is an omnivore and the North American porcupine is a herbivore, only the African porcupine would eat ants and other insects. In fact, the insect is the only animal an African porcupine eats.


What are ants that live in social communities?

ants


Where do ants leave?

If you mean where do ants "LIVE", then the answer would be that they live in ant hills.............................


Can ants live in a box?

I believe carpenter ants can.


Where do ants live in?

they live in anthills that are made of dirt some are flat and some ants live underground for those who don't know this read about ants they will explain better


What types of insects live in BC?

their are black ants ,red ants ,flying ants

Trending Questions
How do you stop remembering the bad things of the past? What is 'Have a good afternoon' in French? What causes sleep apnea? How do you replace voltage regulator? What do both plants and animals need to survive? If the probability of type 1 error is reduced the probability of type 2 error is also reduced? Why did they use bells on horse harness? If i put 100 dollars in a prepaid credit card will the card be useless until i put more money in it after i spend all 100 dollars or is that the case for prepaid DEBIT cards? How do you say I love you my princess in spa nish? What to do when your ex boyfriend tells you he misses you and still loves you? Who did the Indian National Army fight in World War 2? JLS were runners-up in the 2008 X Factor final but who to? Is hypothalamus responsible for vitiligo? How do you replace tail light 2006 Pontiac Solstice? Lyrics to the song burn this disco out by Michael Jackson? Is it the hose or whole radiator if leaking antifreeze? A river or steam that flows into a larger stream or other bodies of water? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? How much it will cost for 92.7 Big FM radio station in nellore? When did Michael Jordan start to play with th Chicago Bulls?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.