0
What else can I help you with?
Related Questions
Where do animals sleep?
It depends on the animal that your asking for a example an owl sleeps in a tree. A snake dosent sleep that much sometimes at night it hunts for food. A bat sleeps in the daylight inside a cave. And a Eagle sleeps in really tall and old trees!
Does Leonardo DiCaprio sleeps on his stomach?
Yes. He sleeps on his left side. He sleeps on his right side. He sleeps on his back. He sleeps on his belly.
Where does a fennec fox sleep?
IT sleeps were it sleeps
What does Louis Tomlinson do when he sleeps?
he sleeps very beautifully.
How can a man go eight days without a sleep?
He sleeps at night
Where does wolfs sleeps?
A wolf sleeps with its pack, wherever there is room.
When was The City That Sleeps created?
The City That Sleeps was created in 2010.
When was Sleeps with Butterflies created?
Sleeps with Butterflies was created in 2005.
When was Until It Sleeps created?
Until It Sleeps was created in 1994.
When was The Man Who Sleeps created?
The Man Who Sleeps was created in 1974.
When was City Sleeps created?
City Sleeps was created in 2005.
What is the past tense sleeps?
The past tense of sleeps is slept.
Trending Questions
What is the volume of a rectangular prism with a lenght of 10cm a width of 7cm and a height of 5cm?
Who played Seth Bullock on Deadwood?
What is Jenny Craig's phone number?
What do you think the reason is?
What is the percentage of freshwater is groundwater?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
How does the order of characteristics on a branching tree diagram help demonstrate evolutionary history?
What were the Banana Wars?
If a person files for divorce in North Carolina and cannot serve the other spouse with the divorce papers what would be the status of the divorce?
What is 6 over 39?
Can your boyfriend get in love about licking him?
Who appointed Gerald ford as vice president?
Where do they sell cachetadas candy in Houston?
What are the features and benefits of the keychain viewfinder?
Are you a child of a god or goddess?
Are there any male singers whose musical type is Like Amy winehouse or duffy or joss stone?
What is size of Alberta Canada?
Why were conspirators against Caesar?
Change a starter on 99 Acura TL?
Bakit sinasabing nag-simula ang pabula kay Aesop?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.