answersLogoWhite

0

Where does pp place in a?

User Avatar

Anonymous

∙ 12y ago
Updated: 11/4/2022

the end

User Avatar

Arvilla Kemmer ∙

Lvl 10
∙ 2y ago
Copy

What else can I help you with?

Related Questions

Where does pp place in a letter?

the end


Where do you get PP restores in Pokemon diamond?

You can find them or buy them at a place.


Where do you get pp restores in Pokemon Ruby?

all over the place


What is past participle of place?

Place is a regular verb so the PP is placed. place / placed / placed He has placed his cards on the table.


What would be the phenotype PP and pp or all Pp or all PP or all pp?

Yes.


What is a past participle of place?

Place is a regular verb so the PP is placed. place / placed / placed He has placed his cards on the table.


What are two occupations that match the keyword doctors?

Two occupations that match the keyword "doctors" are physicians and surgeons. Physicians are medical professionals who diagnose and treat illnesses and injuries, while surgeons specialize in performing surgical procedures to treat various medical conditions. Both occupations require extensive education and training in the medical field.


What genotype is Pp?

pp


What does a PP Max do?

PP max maxes a chosen move's PP.


How can you raise your pp on SoulSilver?

You can use PP Ups as one method of raising PP. These are found randomly across the map. using pp up and pp max


What is pp up?

pp ups are things that put you're Pokemon's pp up


What is pp?

what is the full form of pp

Trending Questions
What is the molality of a solution made by dissolving 2 moles of NaOH in 6kg of water? Why does joy make suds? Why manuel v pangilinan still single? What is the cost of becoming a teacher? What is the plural form for words ending in ey? What shape has exactly 2 perpendicular sides? Who passes unemployment extensions? What tragedy happened in space exploration in 1986? How do i compare Britain and the 13 colonies in the mid-1700s? Why did slavery end answers for kids? What is the value of an HS .22 cal hand gun? What is the mRNA strand for ggctatatcctgcgctatacgcta? Who is the Cheerleader in nada surf's popular video? How do I lose 2lbs a day on a 1200 calorie diet I'm a 20 year old female weight 258 also how much protein and carbs should I have everyday? Why does George have a toothbrush sticking out of his ear in harry Potter? What are some good ideas for tonight at home? What do you call a fear of curtains? In what song is the line Even Rock Hudson lost his heart to Doris Day? What is the name of polygon with 1000 sides? How long does radiation stay in the body after treatment?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.