answersLogoWhite

0

Where is gent located?

User Avatar

Anonymous

∙ 13y ago
Updated: 3/24/2023

The genting skyway is located in the Genting Highlands in Malaysia.

User Avatar

Eulalia Doyle ∙

Lvl 10
∙ 2y ago
Copy

What else can I help you with?

Related Questions

What is a 4 letter word for gentleman?

gent


What is the four letter word that is short for gentleman?

gent


When was K.A.A. Gent created?

K.A.A. Gent was created in 1864.


When was Edward Gent born?

Edward Gent was born in 1895.


When was Hogeschool Gent created?

Hogeschool Gent was created in 1995.


How do you say I live in gent in french?

J'habite à Gent, if you mean Gent in Belgium then it's J'habite à Gand


When was Cyriel Van Gent born?

Cyriel Van Gent was born on December 5, 1923, in St. Amandsberg, Gent, Flanders, Belgium.


What has the author Thomas Gent written?

Thomas Gent has written: 'Poetic sketches'


Lic corporate gent?

Lic corporate means gent. This is written in Spanish.


When was Peter Gent born?

Peter Gent was born on 1942-08-23.


When was A Gent from Bear Creek created?

A Gent from Bear Creek was created in 1937.


What is Sas van Gent's population?

The population of Sas van Gent is 3,753.

Trending Questions
Can a parent kick you out if you are over the age of 18? What is the Gosselin family's political affiliation? How tall is Radhaa Nilia? What level does lombre learn fake out? Which of the following is NOT one of the so-called pillars of primary health care as outlined by the Declaration of Alma Ata? What are animal claws used for? What is the distance between two longitudes at the equator? Does ingrown toenail surgery hurt? When was Black dress of Rita Hayworth created? Who does Mr Pilkington represent in Animal Farm? Is the moon made out of sand? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What if caffeine does not have an effect on you? What is the definition of futile? Why is there an Australian midget pooping in your attic? How much does a cintas ssr make? Michael's Coupons? What does miogynistic mean? What are three examples of governmental actions that might interfere with free market? What are the 4 major civic duties?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.