0
David LeNeveu was born in Fernie, British Columbia on 05-23-83.
What else can I help you with?
Related Questions
When was David LeNeveu born?
David LeNeveu was born on 1983-05-23.
How tall is David LeNeveu?
NHL player David LeNeveu is 6'-01''.
How old is David LeNeveu?
NHL player David LeNeveu was born on 05-23-83 and as of the end of the 2013-2014 season is 31 years old.
Does David LeNeveu shoot right or left?
NHL player David LeNeveu shoots left.
How much does David LeNeveu weigh?
NHL player David LeNeveu weighs 190 pounds.
What NHL team does David LeNeveu play for?
David LeNeveu plays for the New York Rangers.
What position does David LeNeveu play?
David LeNeveu plays goalie for the New York Rangers.
What is David LeNeveu's number on the New York Rangers?
David LeNeveu is number 29 on the New York Rangers.
When was Eleazar David David born?
Eleazar David David was born in 1811.
When was David Stockings born?
David Stock was born in 1939.
When was David born and where was David born?
David Henrie Was born in Los Angelees and he is 22.
When was David Candelaria born?
David Candelaria was born in 1976.
Trending Questions
When was Northern Nevada Correctional Center created?
Is wood laminate flooring cheap?
What are the names of the main characters in the thief?
Where might one look to find a United Airlines flight status?
What is Bruno Mars favorite season?
How do you clean pet urine from suede sofa?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
What does RAFT stand for in language arts?
What is Heller's test?
What are the list of Aerial Animals?
What are the gifts for run santa run in doodle god?
Where does a ship park?
Which system has parties that are made of coalitions?
What is the meaning of intermediate?
What does non recyclable mean?
Why the Framers did not anticipate the feature of the electoral college system?
Why did Hollis run away from the regans family in pictures of hollis woods?
What innate behavior does a white tiger have?
Which clan did the Yamato clan originate?
What to do to a chicken when it has been attacked by a dog and still alive?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.