0
What else can I help you with?
Related Questions
Who made opera mini?
Opera Mini was developed by Opera Software
What palace is the Paris opera house that was made famous in The Phantom of the Opera?
sydney opera house
Ivanhoe was not made into a?
opera
What is the Sydney Opera House mainly made out of?
How big is the Sydney Opera House?
What is the Sydney opera house mainly made of?
How big is the Sydney Opera House?
Why was the Sydney Opera House made?
The Sydney Opera House was made because Sydney needed a bigger theatrical space.
When was the sydny opera house made?
the sydney opera house was made in the olden days when we only just knew the word "ummm"
What is the opera house made of?
The opera house is made of the same materials that most buildings are. These materials include wood, plastics, and cements.
When was The Violanta made?
If you mean the Korngold opera., it was made in 1916.
In Phantom of the Opera how did the new owners of the opera house make the fortune?
They made it in the junk business.
Who made his debut at the metropolitan Opera in 1982?
As numerous males made débuts it is best to contact the librarian of the Met Opera who might give you a list.
Who made the Soap Opera?
The soap opera format was created by Irna Phillips in 1937 on radio soaps.
Trending Questions
Tattoos that represent travel?
Which of the events was most influential in bringing the US into the world war 2?
What were the elements and functions of god myths?
Give two types of evidence for continental drift with an example of each type?
When you rate their depression on a scale from 1-10. their response are what in your study?
What is the distance between the points (1 -2) and (-93) on a grid?
Why were marriages arranged in Shakespeare's time?
Why does carbon conduct electricity if it is a non metal?
What should you do if the application of one Combat Application Trouniquet does not stop bleeding?
What is minimum age of a imam?
Would mung bean grow without water?
How many amps does a one horse power motor draw?
How long will it take to run 1.5 miles at 7 miles per hour?
Is sign language a forgen language?
What language do Wales people talk?
What is a catchy title for a science fair project on heat?
What words have the same vowel sound as the word ground?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the common name for the spine?
How many people use health app from their cell phone?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.