0
What else can I help you with?
Related Questions
Is oriste from jls gay?
Jls are not gay!
Is anybody gay from jls?
Yes Astin from jls is gay.
Wich 1 of jls is gay?
None? Why are people asking so many of these! there not gay, get over it!
Who out of jls is gay?
NONE OF JLS ARE GAY if you think they are you are mad and jealous.
Who are the gays in jls?
None of the members of JLS are gay.
Is jb and orisay from jls gay?
NO! all of JLS are straight!
Which jls person is gay out of jb and Aston?
Nonee!!!! ... no one in JLS are gay. i hope not nway :S
Which of jls is gay?
NONE of them
Who is gay from JLS?
None of them
Is marvi from JLS gay?
No he is not!!!
Witch on is gay out off jls?
None of them are gay.
Who out of JLS are gay?
everyone not one person is not gay
Trending Questions
How do you get relichant in Pokemon?
British most wanted?
How many grams is 4 cups of diced apples?
What are the differences between water erosion and water deposition?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
How does the process of newborn skull development impact overall growth and development in infants?
What causes a transaxle on my 2005 Ford Freestar to get hot?
Who kills Alison in Pretty Little Liars?
Are there any data free usage apps on iPhone?
Different Types Of Arousal in sport?
Where do toadfish live?
How can you call the people on a congregation?
How long does it take for a tree to fully be grown?
When does Suburgatory season 2 come out on DVD?
What is the mission statement for abbott labs?
What was the delorian car made of?
How much does a steinway d cost?
How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L?
How do you tell how old a terrapin is?
What is 4198 to the nearest 100?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.