0
What else can I help you with?
Related Questions
Who director the indian film guru?
Mani Ratnam is the director of the Indian film Guru.
What is the duration of The Indian in the Cupboard film?
The duration of The Indian in the Cupboard - film - is 1.6 hours.
What is the duration of Indian Uprising film?
The duration of Indian Uprising - film - is 1.25 hours.
Who is known as the father of Indian film industry?
Dadasaheb Phalke is the father indian film industry.
When was The Indian in the Cupboard - film - created?
The Indian in the Cupboard - film - was created on 1995-07-14.
When was London Indian Film Festival created?
London Indian Film Festival was created in 2010.
When was American Indian Film Festival created?
American Indian Film Festival was created in 1975.
When was Indian Uprising - film - created?
Indian Uprising - film - was created on 1952-01-02.
abhimaan indian film?
indian full movie
When was South Indian Film Artistes' Association created?
South Indian Film Artistes' Association was created in 1952.
Who was the first Indian woman to appear in an Indian film?
tiquawaija majkama
Who was the first Indian women to appear in an Indian film?
Kamala Bai Gokale
Trending Questions
Where did the Fist Slipper originate from?
What factor is absent in aphotic zone?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
Are cypress hills still together?
What does the name Guadalupe mean?
What is the biggest rhino ever recorded?
What are the functions of a megacity?
Where are the Pandora stockist on gold coast?
How did Adele loose her voice?
Can a child abuse record Be sponge by the state in the courtroom?
B S degree stands for what?
Can asking an employee when she plans to retire be seen as age discrimination?
What does some shall be pardoned and some punished mean?
Is Polaris PS-4 oil a synthetic oil?
Did Hannah Barbara have a husband?
What happened as a result of Alexander the Great's rise to power?
How can i increase my weight from 60kg to 70kg?
Is the word butterbeer copyright?
What is the smallest crater on the moon?
How do you do kamehameha on dragon ball fighting 1.7 for player 2?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.