0
Abraham Lincoln main hero was George Washington because he was in the revolutionary war and some other reasons but i can not remember it from my book for my biography.
What else can I help you with?
Related Questions
What were Abrahams challenges?
Abrahams challenges were that he had to protect his kids.
When was Frederik Abrahams born?
Frederik Abrahams was born in 1990.
When did Irving Abrahams die?
Irving Abrahams died in 1998.
How tall is Lauren Abrahams?
Lauren Abrahams is 5' 4".
When was Carl Abrahams born?
Carl Abrahams was born in 1911.
When did Carl Abrahams die?
Carl Abrahams died in 2005.
When was Chris Abrahams born?
Chris Abrahams was born in 1961.
When was Rehane Abrahams born?
Rehane Abrahams was born in 1970.
When was Esther Abrahams born?
Esther Abrahams was born in 1771.
When did Sidney Abrahams die?
Sidney Abrahams died in 1957.
When was Sidney Abrahams born?
Sidney Abrahams was born in 1885.
When did Israel Abrahams die?
Israel Abrahams died in 1925.
Trending Questions
Where should a seven branched menorah be placed?
Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint?
Remove the front door speaker landcruiser?
How high did sputnik go up?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
Which describes an aspect of total war as it was practiced during the Civil War?
What is the Irish Gaelic for 'fire earth metal water and wood'?
How can cactus be more useful than a rose?
What do governments do to stabilize the economy?
What are the harmul affects oxycodeine?
What is 10 percent of 650000?
Can you use frozen vegetables that have thawed?
How do you get a Disney copyright permission?
How do you round 735901 to nearest hundred thousand?
What is the 2013 murder capital?
What maths do you need to know to become an electrician?
Calculate heat of fusion?
Why some of the word use ed at the end of a word?
Can cocci bacteria be found in animals?
Timely filing limit for blue cross in Texas?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.