0
What else can I help you with?
Related Questions
Who does Taylor ozment love?
the truth is: Sandy Ozment, Tatum Ozment, Jeff Ozment, and Tory Ozment. [don't delete!]
What is the birth name of John Ozment?
John Ozment's birth name is John Alan Ozment.
What is the birth name of Sam Ozment?
Sam Ozment's birth name is Samuel Jesse Ozment.
When was Steven Ozment born?
Steven Ozment was born in 1939.
How tall is John Ozment?
John Ozment is 5' 5".
How tall is Nicole Ozment?
Nicole Ozment is 166.4 cm.
What is the birth name of Nicole Ozment?
Nicole Ozment's birth name is Nicole Renee Chelini.
When was Sam Ozment born?
Sam Ozment was born on May 1, 1929, in Arkansas, USA.
When was John Ozment born?
John Ozment was born on March 11, 1958, in San Jos, California, USA.
When did Sam Ozment die?
Sam Ozment died on March 22, 1982, in Van Nuys, California, USA.
Is ozie ozment blind?
Yes
What is the birth name of Eddie Cruse?
Eddie Cruse's birth name is Eddie Dean Cruse.
Trending Questions
Roosevelts New Nationalism program primarily hoped to?
Two numbers have a sum of 31 and a product of 228 What are the numbers?
What Native American group that lived in the American southwest also known for cliff dwellings?
Who were the green police of Holocaust?
What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?
What does it means when a boy says there were taking a cold shower?
How do you get the clear bell in Pokemon liquid crystal?
Who got ball first in the Super Bowl this year?
What is the trigonometric values 82 degrees and 12 minutes using 3 major functions?
What should one do during a lion attack?
What is 42 over 441 in simplest form?
What percent of people in their late teens and early twenties have credit cards?
What does an egg represent when given as a gift?
What is a plutino?
When was Dónal Clifford born?
How did the northerners and Southerns view the secession of the south States?
What is Freeze Screen Saver exe Is it good or bad. Should I remove it from PC?
What happens when a relay is operated beyond its rated voltage or current?
What does tu es amusant mean?
What is the motto of Tintern Schools?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.