answersLogoWhite

0

Who doesn't have a girlfriend in one direction?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/20/2019

Harry and Niall.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Why doesn't Harry Styles get a girlfriend?

Probably because he is busy with One Direction and doesnt want a girlfriend at the moment


Do russy simmons have a girlfriend?

he does not have one


Who is ryeowook girlfriend?

He doesnt have one.


Why doesnt Louis sing in one direction?

he does or else they wouldnt be one direction


Who in one direction have a girlfriend?

liam


Does prince Jackson have a girlfriend?

no he doesnt and he is not looking for one


How does Trey Songz's girlfriend look?

He doesnt have one


Does One Direction have a girlfriend?

Groups do not have a girlfriend. Individual members may have.


Is Zayn Malik from one direction got a girlfriend?

No, Zayn does not have a girlfriend


Does harry of One Direction have a girlfriend?

No. As of 2012 he does not currently have a girlfriend. His previous girlfriend was Caroline Flack.


Does one direction have girlfriend in 2013?

yes


Does Liam in One Direction has a girlfriend?

sadly.

Trending Questions
Is there a recall on 2006 PT cruiser? Where do you go to get a permit to put up a fence in LA? What is the mRNA strand for ggctatatcctgcgctatacgcta? In legend of Zelda spirit tracks I cannot reach the ice temple stamp station my boomerang does not reach the icy fire in that room how do I get the stamp? Which Ohio State Football player is called Animal? Worsted system and woolen system? What is another name for a tire's height? How many days old are you today if you were born March 8 1949? Is ohm's law applicable to ac or dc and why? Son and daughter of Ferdinand Magellan? How big is Selena gomez's mole? What is the value of a 2003 US dollar coin? Animals in trenches? Does Minnesota have tolls on its roads? What is 147 square feet converted to square meters? Is this statement true premiums for term life insurance decrease as people get older? What should I do if my toilet has a weak flush? When was Mann Kee Awaaz Pratigya created? What is the recipricol of 7654321? What is the unit price of a product?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.