0
What else can I help you with?
Related Questions
Who is supporting jls at the metro radio arena?
Starboy Nathan and two others I think
Who is jls special guests at march 24th 2012 02 London arena?
NVS, Vida, and Starboy Nathan
Who is the supporting act JLS 2012 tour?
I know who is supporting March 17th 2012 at LG Arena Birmingham. A fab new girl dance crew called InSync....
Where are JLS boys from?
Jls Boys Are From London
Are jls supporting the wanted?
no
Are JLS touring again in 2012?
thewy are ment to be doing their own tour later this year so i have heared about september
Where are JLS currently living?
I think JLS are currentley living in London.
Is jls singing at shefield arena?
Yes, during their tour.
Are jls supporting westlife at croke park?
no
Is jb from jls from south London or west London?
he is from south London
Where was Marvin from JLS born?
Marvin Humes 4rom JLS was born in South East London
Were about does jls live?
London i think.
Trending Questions
What should you do to leave merry-go-round in order not to fall down?
What is the meaning of the laundry pin on a bikers jacket?
What is the chemical that blocks most of the ultraviolet light from reaching earth?
How many ATM of pnb in kolkata?
Im almost 15 and im 5'2 most of my friends are taller than me am i under the average do you think?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is the last sense to leave the body when you die?
How did Girl Guides begin?
What was one of the archangels named in the Hebrew tradition?
Why is RNA needed in a cell?
Where did endless shoes come from?
Why did the US intervene in the Mexican Revolution?
How much did Turtle win in the Westing Game?
Why did New Zealand john walker become a athlete?
How willu obtain butan-2-ol from propanal?
How do you get on top of Hideki tower on Skate 2 for Xbox 360?
When did Samuel Tertius Galton die?
Where can you buy vernors in Michigan?
What is the largest nuclear charge of group 2?
Does Connecticut have a football team?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.