0
What else can I help you with?
Related Questions
What river is the founder of the Victoria falls?
The Zambezi River
What are famous waterfalls in Zimbabwe and Zambia?
Victoria Falls is on the border of Zimbabwe and Zambia.
What is faster Victoria Falls Or Niagara Falls?
Niagara Falls is Much faster than Victoria falls and Victoria Falls is Much Higher!
What city is Victoria Falls in?
Victoria Falls is located between Livingstone, Zambia and Victoria Falls, Zimbabwe.
What coutry is Victoria falls?
Victoria Falls is in Zimbabwe.
What is the distance between Victoria fall airport and Victoria falls hotel?
The Victoria Falls Hotel is 22 km from the Victoria Falls Airport.
What is Victoria falls made out of?
Victoria falls is made out of molten lava.
Who is Victoria of Victoria's Secret?
The founder of the store
Did Queen Victoria stay at the Victoria Falls Hotel?
Queen Victoria did not see the Falls
River of Victoria falls?
The Victoria Falls are on the Zambezi river.
What is the Victoria falls culture?
Victoria falls culture is African
Is there a rain forest in Victoria falls?
well da it is Victoria falls
Trending Questions
Does zinc corrodes with water?
What is Ariana Grande's brother's name?
What is fi On the periodic table?
What city was established in 1718?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is weird al's favorite song?
How many square mile is Iowa?
How do I set the clock on my Honda jazz?
How often should you check your credit report?
Was germanicus Caligula's friend?
What website lets you print free Yu-Gi-Oh cards?
What is 5s concept?
What are 20 devices people use daily that uses computer technology?
What are North Carolina capital resources?
Can anyone confirm whether it is true that King George III was obsessed with time and had a palace full of clocks?
Hello I suffer from hypothyroid disease Is there anything I can do to regrow my hair that I have lost in the top area and the right side of my head If so Please let me know.?
What is the Ecuador's largest city?
On the Mercedes C230 it shows a left back light tail light malfunction message when the lights are on.?
Is salad insoluble?
Can a 11 year old own a gun?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.