0
What else can I help you with?
Related Questions
What did Franklin and crick and Watson and Wilson do?
Franklin, Crick, and Watson were scientists who made significant contributions to understanding the structure of DNA. Franklin's X-ray diffraction images provided crucial information about DNA's helical structure, which Watson and Crick used to propose the double helix model. Wilson is not typically associated with this work.
James Watson and Francis Crick amended Franklin and Wilson's conclusion and determined that the shape of the molecule was instead a?
A double helix!
How many brothers and sisters did Francis Crick have?
Francis Crick had one brother, Anthony Crick.
When did Stanley Crick die?
Stanley Crick died in 1955.
When did Thomas Crick die?
Thomas Crick died in 1970.
When was Thomas Crick born?
Thomas Crick was born in 1885.
When was Paddy Crick born?
Paddy Crick was born in 1862.
When did Paddy Crick die?
Paddy Crick died in 1908.
When was Jared Crick born?
Jared Crick was born in 1989.
When did Philip Crick die?
Philip Crick died in 1937.
When was Philip Crick born?
Philip Crick was born in 1882.
When was Bernard Crick born?
Bernard Crick was born in 1929.
Trending Questions
Can musk turtles live with red eared sliders?
What is 59kilos in stones and pounds?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What is the computer game RC Laser Warrior?
Explain how manifest destiny influenced the westward exoansion of the united states in the 1800s?
What are the release dates for Behind the Headlights - 2004 James Dean?
How does climate affect the outcome of history?
What does it mean when water is condensed?
What is the orgin of handkerchief head?
Will anybody give me free players or coins on fifa 13 ultimate team?
Who is the individual responsible for all incident activities including the developement of strategies and tactics and the ordering and release of resources?
How old do you have to be to buy a scope?
When did Rabindranath Tagore write kingdom of cards?
What title is given to eldest son of british throne?
Continental crust are?
What was the goal of macon's bill 2?
What changes have occured in daintree rainforest?
Who was Gerald Nye?
Are Prince Philip and Queen Elizabeth related?
What causes slow hair growth in the armpit?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.