0
What else can I help you with?
Related Questions
What is the name of Oprah Winfrey's show the Oprah Winfrey show?
Oprah Winfrey`s show is called the Oprah Winfrey show!
What was Oprah Winfrey the first at?
Being Oprah Winfrey.
What is Oprah Winfrey's birth name?
Oprah Winfrey's birth name is Orpah Gail Winfrey.
What was Oprah Winfrey's birth name?
Oprah Gail Winfrey
Is vernon Winfrey Oprah Winfrey brother?
vernon Winfrey is Oprah winfreys father not brother
What is the birth name of Oprah Winfrey?
Oprah Winfrey's birth name is Orpah Gail Winfrey.
How does Oprah Winfrey look?
see link below
What struggles did Oprah Winfrey have?
Oprah Winfrey was raped by her cousins as a child.
Who has more money Daniel Radcliffe or Oprah Winfrey?
Oprah Winfrey.
What is the name of Oprah Winfrey's network?
Own. (oprah Winfrey Network)
What is Oprah Winfrey's real name?
Oprah Winfrey's real name is Orpah Gail Winfrey. O-R-P-A-H... as from the Bible texts.
What year did Stedman Graham and Oprah Winfrey get engaged?
thry got married in 1993 but there was no actually date
Trending Questions
How would you define constrictive pericarditis?
Were the medes allies of the Assyrians?
Can you install a flash player on your Wii?
What is 8Cr13MoV stainless steel blades?
What is the basic SI unit of volume called?
What definition of abnormal behavior is Bill using?
What creek or stream is between Creek Rd and S Water in buffalo NY?
Do girls like men in thong underwear?
How do you draw a Halo 3 warthog step by step?
Blood leaves through the semilunar valve and goes into the?
Danger danger lies ahead skirt it with a delicate thread do not stick your chin out or you'll regret it no doubt?
How many places in philippines?
What does cells of eurayotes take place in?
What math classes do you have to take to get into Yale?
What is textile?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What was the main reason that American colonists opposed the stamp act?
Who was Edwin Holmes and Thomas Watson?
What drink is made in England?
How do you do a flipnote on computer?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.