0
me
What else can I help you with?
Related Questions
What is the first city state to establish democracy?
Athens Greece was the birthplace of democracy.
Did Sparta or Athens have a democracy?
Athens had a democracy; Sparta, an oligarchy.
Who had a limited democracy between Athens and Sparta?
Athens had a limited democracy.
How was democracy in ancient Athens different from democracy in the united States?
The democracy in ancient Athens was a direct democracy. The democracy in the United States was a representative democracy.
Did the Athens or Sparta have a democracy?
Sparta because they did not have as much freedom as Athens.
What is the government is Athens?
Athens had a democracy
Did people of Athens have a full democracy?
Did the people of ancient Athens have a full democracy
What cities was the first place to establish a democracy?
Athens Greece was the birthplace of democracy.
Who had a better democracy America or Athens?
Athens !
Who was the best example of greek democracy Athens or Sparta?
Sparta was a good example of limited democracy, Athens of radical democracy.
Was Athens a representive democracy?
NO,it was a direct democracy
Was Athens a representitive democracy?
No - a direct democracy.
Trending Questions
What has the author Caitlin Moran written?
If every time you get mad and you cry Is this considered depression?
What is a deficiency in the irr?
What is the meaning of advencher?
What did the US government accomplish under the articles of confederation?
What is an example of a saddle joint in a human?
Which province province voted to remain in Canada in 1995?
Who will be returning to Doctor Who for series 4?
How do you mount a bike properly?
Why is the accounting entity concept so fundamental that it pervades all of accounting?
How do dissolved oxygen meters work?
Why was the iron age called the iron?
Who sells iPod nano cases?
What is code p1768 for 99 dodge caravan?
What has happened in the governments of all of Central American countries since they own their freedom from Spain?
What machine generates the mercalli scale?
Where is Samarpur hill station?
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
Can a Ethernet tranceiver be used to adapt a phone the the internet?
What type of epithelial tissue forms the dermis of the skin?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.