0
What else can I help you with?
Related Questions
Is kylie minogue Australian?
Kylie Minogue is Australian pop singer. She was born in Melbourne, Australia.
Kylie minogues first break into career?
she was an actress on the Australian tv soap, Neighbours
What nationality is kylie minogue?
Australian
What is Kylie?
kylie means sport, outgoing, and eternal beauty.
What is a good Australian girl name?
Kylie means a boomerang.
When was Kylie Watson born?
Kylie Watson was born on May 7, 1978, in Canberra, Australian Capital Territory, Australia.
Who is Dannii minouge?
She is the sister of Australian singing superstar Kylie Minougue.
What inspired kylie minogue to become a popstar?
Kylie was in an Australian soap when Dannii was on young talent time so she started off singing then.
What has the author Kylie Kwong written?
Kylie Kwong has written: 'Recipes and stories' -- subject(s): Australian Cooking, Family, Chinese Cooking
Who is Jason Donovan's ex-girlfriend on the Australian soap opera neighbors.?
Kylie
Were there any famous Australian immigrants that came over to America?
Kylie Minogue
Which singer rose to fame on the Australian soap opera Neighbors?
Kylie Minogue
Trending Questions
What was unusual about the emperor's new clothes?
How do you change tail light assembly Toyota Echo?
How many decibels of sound will kill you?
How do you know a object's speed and velocity?
What do Nicki Minaj worship?
Who invented Ouran?
What day of the week was July 4 1997?
What episode of you Love Lucy did the living room window appear in?
What was the significance of Robert E. Lee in the Civil War?
What is a range of data that includes all numbers called?
How much are a pair of Nikon 7x21 6.7 Sprint III worth?
What biome is permaforst?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
Are there practicing Jehovahs witnesses in Cuba?
How many years are creation and the flood apart?
Were high tariffs part of the Isolationism in the US?
What level does magneton learn zap cannon?
Who was on the Boston tea party?
How do you remould a gum shield?
Chlamydomonas is more like a plant cell than an animal why?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.