0
James D. Watson and Francis Crick were prominent in the discovery on DNA. (Deoxyribonucleic acid) Though, some believe that Rosalind Franklin discovered the strictures of DNA before Watson and Crick. These people were the first to write about DNA, it's properties, and it's structural traits.
What else can I help you with?
Why do all cells contain DNA Explain?
DNA is the blueprints of the cell. It will be like trying to write a book without anything to write about. The DNA tells the cell what to do by sending mRNA.
When was the DNA model first used?
When was the first DNA
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
Atgttacgttgaacc write the DNA complement for it?
TACAATGCAACTTGG
Was the Structure DNA first described DNA first described?
1950
What were Watson and crick were first to suggest about DNA?
They were the first to suggest that DNA is in the shape of a double helix.
When was the first DNA model made?
the first dna model was made in 1953 by james watson
How do you battle with your DNA code Bakugan?
You battle with your DNA code bakugan like every other bakugan that are not from a DNA code. First, make sure you used the bakugans DNA code first.
How can you write a sentence with chromatin in the sentence?
Chromatin has DNA and RNA, and is in a nucleus.
Which pieces of DNA will migrate to the bottom of the DNA gel first during electrophoresis?
During electrophoresis, smaller pieces of DNA will migrate to the bottom of the gel first.
What did DNA stand for when it was first discovered?
DNA stands for deoxyribonucleic acid, which was first discovered in the 1860s by Friedrich Miescher.
What shape is DNA as first suggested by Watson and Crick?
DNA is a double helix.
