answersLogoWhite

0

Why do cats get 9 lives?

User Avatar

Anonymous

∙ 16y ago
Updated: 8/18/2019

cats don't get nine lives in normal life, but they do on the warrior series. the Clan leader gets nine lives so they are the first one to lead the battle and the last one to take fresh kill from the fresh kill pile when his/her clan is starving

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

What do cats have 9 of?

9 lives...


What comes in groups of 9's?

Cats have 9 lives


How many lives do cats allegedly have?

A cat has 9 lives.


Do Siamese cats have 9 lives?

no they don't


How long can cats roam for?

9 lives


Is the belief cats have 7 or 9 lives?

Nine.


How does cats have 9 lives?

It doesn't, that is an urban myth.


What do cats have that other animal don't have?

9 lives


Are there any myths about cats?

I'm sure there are plenty... one of them being that 'cats have 9 lives'


Do tabby cats have nine lives?

No, cats do not really have nine lives. It is a fun little myth because cats are so athletic they seem to come "close to death" all the time. if they really had 9 lives they will be undefetable


How many lives ard cats said to have?

Some people believe cats have nine (9) lives. In all reality, cats only have one life. Yet in the Warriors cats book series, the leaders get nine lives. (Good series, by the way).


5 things that come in groups of 9?

9 squares in tic-tac-toe

Trending Questions
What is the difference between a white wizard and a grey wizard? What is a cantus? How long should there be light for a fresh water tank? Who is jimmy studebaker? On a balance sheet what does members' deficit mean? What is a fabrica dearmas oviedo 1931 worth? What does cephalic means in ultrasound? Words that start with the letter g and end with the letter R? What is the song from the Glee commercial lyrics are I'm ready now or something like that? When was greek salad invented? Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water? What are euro notes made of? What is the definition of the word geo? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? You just burned your finger on a pan that just came out of a 400 degree oven what should you do? What was the name of Joey's soap opera? What nationality is the surname Goike? What is the connotation of the word prim? Kasukdulan parte ng sa pula sa puti ni francisco rodrigo? Who wrote the poem street music?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.