0
What else can I help you with?
Related Questions
Are dog fish shark mammles?
Sharks are not mammals. Mammals have hair, give birth to live young and suckle their children. Sharks do not have hair and do not suckle their young.
Do mammles Make the same noise?
I assume you mean "mammals"? In that case, no. Mammals are simply any animal with hair or fur. Humans, cats, dogs, bears...all are mammals. If you really do mean "mammles" I'm sorry because I have never heard of that.
Are jellyfish mammles?
No.
Are people mammles?
yes
Are horses mammles?
Yes.
Are snakes mammles?
no they are reptiles
Do mammles have backbones?
yes.all mammals do
Are alligators mammels?
they are not mammles, they are reptiles.
Witch mammles can fly?
bats
Are zebras mammles?
Yes they are mammals.
Why are apes warm blooded?
they are mammles
Are birds mammles?
no,they belong to phylum of aves.
Trending Questions
I got a Winchester model 88 243 ser67733 its got a Monte Carlo stock and a black tip no checkering any info on this one?
Which of the follwing terms are the core beliefs that motivate attitudes and actions?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
What are all the episodes that Team Magma appear in?
Who are Buddy Rich's children?
40 percent as a decimal?
How old is Jim Lee?
What does a grub look like?
Where is the brake light fuse for Dodge Durango?
What are the top selling gumball flavors in the US?
Theodore Roosevelt's domestic policy was called?
How do you contact with Ikeda Akihisa the author of Rosario plus Vampire?
Stock subscription payables is debt?
What are the reproductive parts of an earthworm?
What celebrities are emos?
Did Benjamin Rush have any siblings?
How are items moved out of a wardrobe in subeta?
What actors and actresses appeared in Bocaue Pagoda Tragedy - 1995?
Can Piccolo and Goku fuse?
Who was jf brondel?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.