0
What else can I help you with?
Related Questions
Are there hobos in pairs?
there are hobos everywhere!
How many hobos Are named Sebastien?
300 hobos
Why are hobos...hobos?
Hobos are Hobos because they don't have a home or sufficient money to buy a home. and because they are hobos
You do girls not love hobos?
because hobos r gross
How any hobos are on Mars?
hobos any on mars, yes.
What is the plural for hobos?
The plural of hobo is hoboes.
Do hobos use math?
no they never learned it if they r hobos
How were hobos made?
Hobos are normal human beings, but ended up not being able to afford a home so they are hobos.
Why are hobos evil?
Hobos are not evil. Hobos are people, homeless people, with all the the same good and bad traits as everyone else.
Do hobos get presents from Santa?
Usually, hobos do not get presents from Santa. Santa brings presents to children and hobos are almost always adults.
Where did hobos eat?
at "south side hobos"
What did hobos carry in there suitcase?
Hobos do not have suitcases, therefore they are poor and homeless.
Trending Questions
Who was Nixon's opponent in the 1960 election?
Who would win walker the Texas ranger or Rambo?
Do the Muslims have weekly church days?
Are theories usually discovered or developed?
Why do cardboard boxes get squashed by a shovel?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What are the benefits of using a home stair climber for improving cardiovascular fitness and lower body strength?
Which technical discipline has the following goal- to demonstrate new and emerging technologies that have a direct application to military systems?
Harriet Beecher Stowe had always opposed slavery?
Is it a pipe or not?
What is a good science fair conclusion?
What is the Italian American population?
What is a mountain range that starts with a c?
Where does Elliot yamin live?
Why was sugar ray important?
What conditions are treated by cyclocryotherapy?
What is mean by sensitive devices?
What measures the average energy of random motion of particles of matter?
What kind of subs should you get for BMW 745i?
What does the letters in electromagnetic mean?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.