0
What else can I help you with?
Related Questions
An ion with more electrons thean protons has what kind of chrage?
A negative change.
What does it mean when a neutron has a neutral charge?
it has no chrage 0 (electrical)
What ion charges do the alkali metals form?
Alkali metals forn cations with the chrage +1.
If an atom has 14 protons 13 neutrons and 16 electrons what is its electrical chrage?
i do not know but i think its 15
What is an ion charge?
This is the electrical charge of the ion.
What does an ion have that a neutral molecule does not have?
An ion has an electrical charge.
An ion is?
An ion is an atom (or group of atoms) with an electrical charge.
What is the name given to the electrical charge on an ion?
The name given to the electrical charge on an ion is a oxidation number. The charge of the ion typically formed by strontium is 2 plus.
Does an ion have an electrical charge?
Yes
An ion is an atom with a net electrical charge due to .?
Gained or lost electron(s).
Is Sakura going to have her own show where she takes chrage?
no
What is the chrage of one electron?
a formal 1 negative
Trending Questions
Where is the Ferrari car manufactured?
Why are my lifters tapping after flood water was drained from the engine and the oil has been changed?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Did Alexander Fleming do bad?
What is the meaning of game over?
What is 390.98 rounded to the nearest square meter?
What are intercalated disks?
Why do you think graphs are a useful way to display information?
Who is lyasan utyasheva?
What objects in outer space can hit earth and cause major damage to earth?
Why do Tamils wear dhotis?
How much is yu gi oh card number 39 utopia worth?
How much should you feed your 30 lb dog?
How much does an aircooled vw engine weigh?
What are organisation management and technology dimensions of information systems?
How many miles from Houston TX to Franklin TN?
What is the correct spelling for Best friend?
What is weight of pressure treated 12 x 12 piling?
Why are my tomato plant leaves drooping and curling?
What is the process that produces starch from the leaves?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.