0
NASA astronaut Neil Armstrong was the first person to walk on the Moon.
What else can I help you with?
Related Questions
When was Neil Armstrong Famous?
Neil Armstrong is still famous. He became famous when he became the first man to step foot on the moon in 1969.I am rude
Who is neil armstrong's wife today?
are neil armstrongs wife and kids still alive
Is Neil still alive today?
Yes , Neil Armstrong , the first man to step on the Moon , is still alive .
Is Neil Armstrong still alive in 2010?
yes Neil Armstrong is still alive in 2010.
Is Neil Armstrong still alive today November eighth 2010?
Yes Neil Armstrong is alive and well in age , he is 79 years old,and lives on his farm in Ohio.
How will you capitalize this sentence neil Armstrong a famous astronaut landed on the moon?
Neil Armstrong is a famous astronaut who landed on the moon.
Who is a famous astronaut?
Neil Armstrong
Did Neil Armstrong want to be famous?
No, he did not.
Who is more famous Neil Armstrong or Bob Marley?
Armstrong
Who is more famous Neil Armstrong or Johnny Depp?
Armstrong
What does neil Armstrong do today?
He is a farmer
How long Neil Armstrong lived?
Neil Armstrong still living on his farm in Idaho.
Trending Questions
Which Italian state led the unification effort?
Who are Jenny O'Hara's children?
What if you go over the 401k limit?
Disadvantages of smoking food?
What color are franck ribery's eyes?
What is the mRNA strand for ggctatatcctgcgctatacgcta?
Which type of acid is carbolic acid?
What is the distance of the sun from Mercury?
Why he doesn't have a girlfriend?
What is stronger luxray or electivire?
How does romanticism apply to the last of the mohicans?
What was the system in which a farmer paid for land?
What would happen if the Earth's temperature rose 2-6 degrees?
The journal entry to record the purchase of treasury stock will cause total stockholders' equity to decrease by the amount of the cost of the treasury stock?
What kind are hamsters with a black body and white feet?
The burial process involving sedimentary rocks is usually?
Is it bad to hate people from other countries for no reason?
How long would it take to ship from British Columbia to La Porte Texas?
How is RNA different from DNA list 3 things?
What is the greatest common factor of 50?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.