answersLogoWhite

0

Yes, a sequence of images can be dramatically connected while being physically disconnected. This often occurs in storytelling, where images may represent different settings, times, or characters but are linked by a common theme, narrative arc, or emotional resonance. Such sequences can create a cohesive experience, encouraging viewers to make connections and infer relationships between the disparate elements. This technique is commonly used in visual arts, film, and advertising to evoke a specific mood or message.

User Avatar

AnswerBot

9mo ago

What else can I help you with?

Continue Learning about Art & Architecture

Head bolt torque and removal sequence for 1994 Nissan pathfinder?

The 1994 Nissan Pathfinder had bolt torque specification is 140 pounds. There is not any removal sequence. There is only a sequence to put the bolts in.


What is the major distribution sequence of vessels of the arterial blood from heart to brain?

WhaT is the major distribution sequence of vessels of the arterial blood from heart to brain


What is the sequence of structures that allows the normal sequence of excitation to progress through the heart?

SA node- AV node- Bundle of His- Purkinje fibers


How do you draw the protein cctgaaggtacgttagttgacatgacg?

To draw the protein sequence encoded by the given DNA sequence (cctgaaggtacgttagttgacatgacg), first, you need to transcribe the DNA into mRNA by replacing thymine (T) with uracil (U), resulting in ccu-gaa-ggu-acg-uua-guu-gac-aug-acg. Then, translate the mRNA into an amino acid sequence using a codon chart, which will yield the corresponding protein sequence. Finally, you can represent the protein structure using software tools like PyMOL or Chimera, or sketch it by hand, showing the primary structure (linear sequence of amino acids) and potentially the secondary and tertiary structures based on the sequence.


What is geological column?

It is an imaginary column where are the ages of rocks sit on top of one another in their proper age sequence, oldest at the base and youngest at the top. An ideal sequence of rock layers that contains all the known fossils and rocks whith each sequence is given its name.

Related Questions

When measuring voltage the probes should be connected in?

can some one please tell me when measuring voltage the probes should be connected to sequence or series?


What dose sequence mean?

a continuous or connected series: a sonnet sequence.Like a chain, or a necklace of pearls, the pearls are in a sequence, one after the other in an orderly fashion.


What is the correct sequence for jumping a car - should the red or black cable be connected first?

When jumping a car, the correct sequence is to connect the red cable first, then the black cable.


Why zero sequence current cannot flow through a star connected machine unless the neutral is grounded?

If the neutral point is not earthed than the zero sequence current will not have any return path.It will be an open circuit for the zero sequence circuit.


What best describes a necessary condition of a series circuit?

In a series circuit, a necessary condition is that all components are connected in a single loop, such that the same current passes through each component in sequence. If one component fails or is disconnected, the entire circuit will be interrupted.


Do coil packs for a 4.2 2003 Chevy trailblazer go in in a certain sequence?

All the coils are the same, each one must be connected to the connector for the cylinder the coil is connected to the spark plug for


Is time abstract?

Yes, time is considered abstract because it is a concept that cannot be physically touched or seen, but is used to measure the sequence of events and the duration of actions.


How do you derive negative sequence impedance of an earthing transformer for 11 KV delta connected 10 MVA source transformer?

Negative sequence and positive sequence are the same for a transformer. You would derive using the same connections as done to calculate the positive sequence impedance. Usually the test report will give positive, and often zero sequence impedances (sometimes left off, depending on the type of transformer as the zero sequence sometimes is the same as the positive sequence). The negative sequence is never given to my knowledge, because it is redundant and unnecessary test.


Which of the following would be the correct command sequence to enable RIP on Router B for all connected networks?

RouterB(config)# router rip


Q' is connected to J input and K equals 1 If clock signal is successively applied 6 times what is output sequence?

010101


What is haiku sequence?

A haiku sequence is a series of haiku poems that are thematically connected. It typically consists of three or more haiku that are related to each other in subject matter, imagery, or emotion. The individual haiku in the sequence may be able to stand alone but together they create a more complete picture or story.


Is a usb flash memory drive a removable hardware device?

Yes, although to properly remove it, you need to perform an eject sequence in software before you physically remove it.