0
UUG
Codon-Anticodon
A - U
T - A
C - G
G - C
Wiki User
∙ 12y ago
Add your answer:
Earn +20 pts
What is the anticodon for CGA?
A pairs with T so the anticodon would be TTT
What anticodon pairs with the codon gau?
The anticodon would be CUA
What is the anticodon for cgc?
The matching anticodon for GCA would be CGU.
Would an anticodon tRNA contain a thymine nucleotide?
It can. If the codon has an "A," then its anticodon must have a "T."
What is the tRNA anticodon for T-A-C?
The tRNA anticodon for TAC would be AUG. However, tRNA does not transcribe DNA and would not come in contact with the nitrogen base thymine. A better question would be what is the tRNA anticodon for the mRNA codon UAC.
What is the anticodon for CGA?
A pairs with T so the anticodon would be TTT
What has an anticodon to bind to the protein synthesizing machinery?
tRNA
What anticodon pairs with the codon gau?
The anticodon would be CUA
What is the anticodon for cgc?
The matching anticodon for GCA would be CGU.
Would an anticodon tRNA contain a thymine nucleotide?
It can. If the codon has an "A," then its anticodon must have a "T."
What is the tRNA anticodon for T-A-C?
The tRNA anticodon for TAC would be AUG. However, tRNA does not transcribe DNA and would not come in contact with the nitrogen base thymine. A better question would be what is the tRNA anticodon for the mRNA codon UAC.
What would the anticodon AAA be complimentary to?
UUU
How does an anticodon compare to a codon?
The anticodon is a sequence of three unpaired nucleotides in transfer RNA, which can bind through base pairing, to the complementary triplet of nucleotides, or codon in a messenger RNA molecule. The codon makes up the genetic code, the anticodon makes the amino acid.
What would be the effect of a mutation that changed the c of the anticodon to a g?
The effect of the mutation is; there would be another amino acid that may form due to the change in sequence of the anticodon. change in the sequence of anticodon may result to different amino acid that may form.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
What does tRNA anticodon bind with?
In normal conditions C always Paris with G and A with U in mRNA so in this CAG the anticoodon wil be GUC
What would be the Anticodon that would join with the codon AUG?
3' UAC 5'
