answersLogoWhite

0

UUG

Codon-Anticodon

A - U

T - A

C - G

G - C

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

What is the anticodon for CGA?

A pairs with T so the anticodon would be TTT


What has an anticodon to bind to the protein synthesizing machinery?

The anticodon on a tRNA molecule binds to a complementary codon on the mRNA during translation. This binding ensures that the correct amino acid is added to the growing polypeptide chain. The interaction between the anticodon and codon is essential for accurate protein synthesis.


What anticodon pairs with the codon gau?

The anticodon that pairs with the codon GAU is CUA. This is based on the rules of complementary base pairing in DNA and RNA.


What is the anticodon for cgc?

The matching anticodon for GCA would be CGU.


What is the tRNA anticodon for T-A-C?

The tRNA anticodon for TAC would be AUG. However, tRNA does not transcribe DNA and would not come in contact with the nitrogen base thymine. A better question would be what is the tRNA anticodon for the mRNA codon UAC.


What would the anticodon AAA be complimentary to?

UUU


How does an anticodon compare to a codon?

The anticodon is a sequence of three unpaired nucleotides in transfer RNA, which can bind through base pairing, to the complementary triplet of nucleotides, or codon in a messenger RNA molecule. The codon makes up the genetic code, the anticodon makes the amino acid.


Which anticondon pairs with the condon gau?

The anticodon that pairs with the codon GAU is CUA. This is because in the process of translation, the tRNA molecule carrying the CUA anticodon will bind to the mRNA molecule with the GAU codon, enabling the correct amino acid to be added to the growing protein chain.


What does tRNA anticodon bind with?

In normal conditions C always Paris with G and A with U in mRNA so in this CAG the anticoodon wil be GUC


What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?

It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.


What would the anticodon tRNA strand be?

The anticodon tRNA strand is a sequence of three nucleotides that is complementary to a corresponding codon on mRNA. For example, if the mRNA codon is AUG, the anticodon on the tRNA would be UAC. This complementary pairing ensures that the correct amino acid is added during protein synthesis. Each tRNA molecule carries a specific amino acid that corresponds to its anticodon.


What is the matching anticodon for UUU?

The matching anticodon for UUU is AAA. A ribosome pairs the UUU codon on the mRNA with the AAA anticodon on the tRNA during protein synthesis.