0
Benutrex C is made up of vitamins B-1, B-12, B-2, B-3, vitamin C, B-5, and B-6. Benutrex C is classified as an antioxidant.
Wiki User
∙ 9y ago
Add your answer:
Earn +20 pts
What is the classification of ketamine?
dont do drugs K is class C
What derivative classification concept is used to classify the document?
The properly marked source document states: (C) Attendance at the meeting is limited to squadron commanders. The new document states: (C) Squadron commanders will attend the meeting. What concept is used to derivatively classify the statement in the new document? Contained in Classification by Compilation Revealed by Directed by
What derivative classification concept is used to classify this document?
The source document states: (S) The process takes three hours to complete. The new document states: (S) The process takes three hours to complete. Which concept was used to determine the derivative classification of the new document? Extension Revealed by Contained in Compilation
Scientific classification of coconut?
The scientific name of coconuts is Cocos nucifera
What is the nonsense strand of DNA sequence t-a-c-c-a-a-g-c-t-a-c-c-t-a-t-t-a-a-c-c-g?
atggttcgatggataattggc
What is benutrex?
Benutrex is a supplement which contains B-vitamins as well as vitamin C. It is still under clinical trials for use in the United States but is already in use in other countries.
How do you dilute Benutrex C ampule?
it comes with a diluent...you just have to aspirate the liquid part of the benutex then incorporate it to the ampule which has the powder form
What is the legal classification for tranquilizers?
Classification for Tranquillisers is class C
What has the author C Faber written?
C. Faber has written: 'Classification of algebraic varieties' -- subject(s): Congresses, Classification theory, Algebraic varieties
What is The API C classification for lubricating oils pertains to which type of engines?
The C classification of oil is for diesel engines.
What has the author A C Jermy written?
A. C. Jermy has written: 'The Phylogeny and Classification of the Ferns'
What is class c?
"C" is an arbitrary designation given to an arbitrary classification devised to classify something.
What is the classification of ketamine?
dont do drugs K is class C
What is the wolf's classification?
Scientific classification of the wolf:Kingdom: AnimaliaPhylum: ChordataClass: MammaliaOrder: CarnivoraSuborder: CaniformiaFamily: CanidaeGenus: CanisSpecies: C. lupusBinomial name: Canis lupus
Graphite is a classification of what kind of matter?
Graphite is a form of the element Carbon (C).
What has the author Beatrice C Rombough written?
Beatrice C. Rombough has written: '[ Classification outline for provincial government documents'
What are the levels of classification for a coyote?
Scientific classification of the coyote:Kingdom: AnimaliaPhylum: ChordataClass: MammaliaOrder: CarnivoraSuborder: CaniformiaFamily: CanidaeGenus: CanisSpecies: C. latransBinomial name: Canis latrans
