answersLogoWhite

0

The time it takes for a bug to die in a light fixture can vary depending on the type of bug and the conditions in the fixture. In general, it may take a few hours to a few days for a bug to die in a light fixture due to heat or lack of food and water.

User Avatar

AnswerBot

8mo ago

What else can I help you with?

Related Questions

How long does take for a bug to go down?

It depends on the size of the bug. Many are too large to swallow.


How long does it take to shade in a lady bug tattoo?

depends on how big it is.


How long will it take a bug to fly 12 miles if the bug flies at 1.7 mile per second?

7.6 seconds


How long does it take lady bug eggs to hatch?

it will take them 5 min


What should I do if I find a tiny brown bug with long antennae in my home?

If you find a tiny brown bug with long antennae in your home, you should try to identify the bug to determine if it is harmful or not. You can then take appropriate action, such as removing the bug or contacting a pest control professional if needed.


How long is a bug?

a potato bug is 3 potaos long


How long do bug bites generally take to heal?

The length of time a bug bite will take to heal will depend largely on what bug has bitten you. A mosquito bite can take a day or two to go away while there are some ant and spider bites that may take weeks to heal and need proper treatment.


What characteristics distinguish a light brown bug with long antennae from other insects in its habitat?

The light brown bug with long antennae can be distinguished from other insects in its habitat by its specific coloration, antennae length, and overall body shape. These characteristics help differentiate it from other insects in the same environment.


What should I do if I find a tiny light brown bug in my home?

If you find a tiny light brown bug in your home, you can try to identify it to determine if it is harmful or not. If it is a common household pest like a carpet beetle or a bed bug, you may need to take steps to eliminate them, such as cleaning and vacuuming thoroughly. If you are unsure of what type of bug it is, you can contact a pest control professional for assistance.


What does yellow porch light mean?

Yellow porch lights are bug lights. By bug light I mean they are not supposed to attract bugs as bad as regular light bulbs.


Have you ever encountered a long black bug in your bed?

No, I have not encountered a long black bug in my bed.


What is the identification of a small brown bug with a light brown stripe?

The small brown bug with a light brown stripe is likely a carpet beetle.

Trending Questions
What events must occur in the cell to prevent each checkpoint protein from sending a message to the nucleus to destroy the cell? A place where dark reactions occur? If a tree releases carbon di oxide in night time then what is the use of Tree? DNA isolated from water samples collected in six different sites was prepared and analyzed by gel electrophoresis for the presence of carp. The resulting gel is shown. Lanes 1 through 6 contain the DN? Why would bacteria have need of these genes on their plasmid? What is the process through which water is lost through the plant's stoma? A human skeleton that is taken apart is called what kind of skeleton? What was Mendels contribution to the study of biology? How is a schwann cell similar to an oligodendrocyte? What helps form ribosomes, where proteins are assembled? How is Blood drained from the liver? Could you list the 17 elements essential for plant growth and the primary function of each in plants? How does a cell respond to its external environment and what mechanisms are involved in this response? What is louies important dates in his life? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? What are the end product of the classes of food? Is there a specific reason why your left eyebrow appears to be raised higher than the right"? What size is the largest bacterium? What do hypae typically support? What are the most effective treatment options for managing a hypergranulation wound?