0
Mrna has the following condons agu-ggu-cga what would the anticodons be on tRNA?
Wiki User
∙ 14y ago
uca-cca-gcu
Wiki User
∙ 14y ago
Add your answer:
Earn +20 pts
What is the anticodon for cgc?
The matching anticodon for GCA would be CGU.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
Which of the following molecules would be blocked by a cell membrane?
IONS!
Which of the following would be an effect of emigration?
An increase in oil drilling would increase the risk of pollution.
Where would the following probably take place?
"Would you like to send the package priority?Do the contents need to be insured.
Anticodons would be characteristic of?
tRNA
Why are condons and anticondons important?
its codons and anticodons and they determine the alanine, cytosine, guanine, thymine, and urcail in amino acids. without them we wouldn't have DNA and no one would be here. they match up DNA strands to determine your genotype and phenotype. i know it sounds like a bunch of jibber jabber but that's what it is haha.
If the strand of DNA has the nucleotides TACCGGACCTGAAGT what would the mRNA strand be?
First of all, it is codons,not condons. MRNA would have uug auc cca. If I am not incorrect, you only use the term codons for MRNA, not in the actual DNA strand. The Anticodons would then be in the TRNA, which codes for the Amino Acids needed by the cells.
Which molecule would you expect to find codons?
Codons are groups of three nucleotides on the mRNA strand. Codons are bound to the ribosomes where they are met by tRNA's anticodons. Together, the codons and anticodons form amino acids which bind together via peptide bonds and form amino acid chains known as polypeptides or proteins. These proteins are released into the cell to perform their desired functions.
What is the anticodon for cgc?
The matching anticodon for GCA would be CGU.
Round the following numbers to the nearest 10?
And the following numbers would be...
If you where to measure a length of a fence which of the following S1 units would you use?
There are no "following" units, but I would use metres.
What is 42 weeks from July 30?
Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.
What would be phi?
Which of the following would be considered PHI
What is the shape of the bases for the following polyhedron?
It would help if the "following" did actually follow!
Which ordered pair replacement would make the following relation a function?
The following is the answer.
Which of the following would be the most effective feedback to give in a peer review?
Where are "the following"?
