0
What else can I help you with?
What is the anticodon for cgc?
The matching anticodon for GCA would be CGU.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
In which molecule would you find an anti-codon?
an anti-codon is a code for an amino acid found on protein
What is the relationship between codons and anticodons?
A codon is found in the DNA sequence and in the mRNA sequence. The anticodon is the opposite sequence that would match with the sequence of the codon and allows pairing of the anticodon with the codon
Where would the following probably take place?
"Would you like to send the package priority?Do the contents need to be insured.
Why are condons and anticondons important?
its codons and anticodons and they determine the alanine, cytosine, guanine, thymine, and urcail in amino acids. without them we wouldn't have DNA and no one would be here. they match up DNA strands to determine your genotype and phenotype. i know it sounds like a bunch of jibber jabber but that's what it is haha.
Anticodons would be characteristic of?
Anticodons are characteristic of transfer RNA (tRNA) molecules. They are sequences of nucleotides within tRNA that are complementary to codons in messenger RNA (mRNA), allowing tRNA to correctly decode the genetic information in mRNA during protein synthesis.
What is the anticodon for cgc?
The matching anticodon for GCA would be CGU.
Which molecule would you expect to find codons?
Codons are groups of three nucleotides on the mRNA strand. Codons are bound to the ribosomes where they are met by tRNA's anticodons. Together, the codons and anticodons form amino acids which bind together via peptide bonds and form amino acid chains known as polypeptides or proteins. These proteins are released into the cell to perform their desired functions.
If the strand of DNA has the nucleotides TACCGGACCTGAAGT what would the mRNA strand be?
First of all, it is codons,not condons. MRNA would have uug auc cca. If I am not incorrect, you only use the term codons for MRNA, not in the actual DNA strand. The Anticodons would then be in the TRNA, which codes for the Amino Acids needed by the cells.
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
It would be UAC. RNA does not use thymine. It replaces it with Uracil. So instead of TAC it will be UAC.
In which molecule would you find an anti-codon?
an anti-codon is a code for an amino acid found on protein
Round the following numbers to the nearest 10?
And the following numbers would be...
What codon on mrna would match this anticodon?
To determine the codon on mRNA that matches a given anticodon, you need to know the complementary base pairing rules. Anticodons are found on tRNA and are complementary to the mRNA codons. For example, if the anticodon is 3'-AUC-5', the corresponding mRNA codon would be 5'-UAG-3'.
If you where to measure a length of a fence which of the following S1 units would you use?
There are no "following" units, but I would use metres.
What is 42 weeks from July 30?
Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.Usually the 20th of May. If the following year is a leap year, then it would be the 19th of May.
What would be phi?
Which of the following would be considered PHI
