The Genetic code.
DNA - Did not attack! No, really DeoxyriboNucleic acid - strands of proteins in a double-helix (2 spinning strands.) It's composed of proteins named Adenine, Thymine, Guanine and Cytosine. The code looks like this:
ACCTAATCAGAATAAACCACA (and so on)
the proteins attach in a line AND from one helix to the other.
A - G
| |
T - C
| |
C - A
| |
G - A
and so on - it spins downward.
Depending on what level of biology you're in, either the nucleus or the nucleolus. During mitosis and meiosis, however, the cytoplasm contains the chromosomes.
The nucleus is the part of the cell that contains chromosomes. Chromosomes are made of DNA and contain the genetic information necessary for cell function and replication.
In a eukaryotic cell, the chromosomes are located inside the nucleus. For a prokaryote, the single, circular chromosome is in the cytoplasm.
The nucleus is the part of the cell that contains chromosomes made of DNA. Within the nucleus, the DNA is organized into structures called chromosomes, which contain the genetic information of the cell.
The nucleus of the cell contains the chromosomes. Chromosomes are made up of DNA and proteins and carry genetic information that determines an organism's characteristics.
Yes, the nucleus contains chromosomes of a cell.
No, a human cell nucleus contains 46 chromosomes, which come in 23 pairs.
Depending on what level of biology you're in, either the nucleus or the nucleolus. During mitosis and meiosis, however, the cytoplasm contains the chromosomes.
The nucleus contains the chromosomes. Chromosomes are suspended in the nucleoplasm of the nucleus of a cell.
The nucleus.
The nucleus is the part of the cell that contains chromosomes. Chromosomes are made of DNA and contain the genetic information necessary for cell function and replication.
The nucleus.
In a eukaryotic cell, the chromosomes are located inside the nucleus. For a prokaryote, the single, circular chromosome is in the cytoplasm.
part of cell that contains the chromosomes
The nucleus is the part of the cell that contains chromosomes made of DNA. Within the nucleus, the DNA is organized into structures called chromosomes, which contain the genetic information of the cell.
contains the chromosomes
nucleus