answersLogoWhite

0

The Genetic code.

DNA - Did not attack! No, really DeoxyriboNucleic acid - strands of proteins in a double-helix (2 spinning strands.) It's composed of proteins named Adenine, Thymine, Guanine and Cytosine. The code looks like this:

ACCTAATCAGAATAAACCACA (and so on)

the proteins attach in a line AND from one helix to the other.

A - G

| |

T - C

| |

C - A

| |

G - A

and so on - it spins downward.

User Avatar

Wiki User

17y ago

What else can I help you with?

Related Questions

Does a nucleus contains chromosomes?

Yes, the nucleus contains chromosomes of a cell.


Does Nucleus in a human body cell contains 44 chromosomes?

No, a human cell nucleus contains 46 chromosomes, which come in 23 pairs.


What cell structure contains the chromosomes?

Depending on what level of biology you're in, either the nucleus or the nucleolus. During mitosis and meiosis, however, the cytoplasm contains the chromosomes.


What chromosome contains?

The nucleus contains the chromosomes. Chromosomes are suspended in the nucleoplasm of the nucleus of a cell.


What contains the chromosomes of the cell?

The nucleus.


What part of the cell contains chromosomes?

The nucleus is the part of the cell that contains chromosomes. Chromosomes are made of DNA and contain the genetic information necessary for cell function and replication.


What part of the cell holds genetic information?

The nucleus.


What part of a cell contains chromosomes made of DNA?

In a eukaryotic cell, the chromosomes are located inside the nucleus. For a prokaryote, the single, circular chromosome is in the cytoplasm.


Part of the cell that holds the chromosomes?

part of cell that contains the chromosomes


Which part of the cell contains chromosomes made of DNA?

The nucleus is the part of the cell that contains chromosomes made of DNA. Within the nucleus, the DNA is organized into structures called chromosomes, which contain the genetic information of the cell.


What is the Function of cell nucleus?

contains the chromosomes


What is the part of the cell that contains chromosomes?

nucleus