answersLogoWhite

0

No

User Avatar

Haven Walter

Lvl 10
4y ago

What else can I help you with?

Related Questions

Why is point mutation dangerous?

A frame shift mutation destroys the correct sequence of amino acids from the point of the mutation. The protein produced by a frame shift mutation would more than likely be nonfunctional.


Can a point mutation be frameshift mutation?

No


Can a point mutation result in a frameshift mutation?

Yes, a point mutation can result in a frameshift mutation if it occurs in a coding region of a gene and disrupts the reading frame of the genetic code.


Which of the following is a point mutation that does not produce a frame shift?

A point mutation that does not produce a frame shift is when one single base is replaced by a different base. This changes the DNA sequence, but does not cause a frame shift because it is a switch not an addition or subtraction of a base.


What is a senqence a result of point or frame-shift?

A sentence that results from a point mutation might be: "The cat sat on the mat," whereas a frame-shift mutation could lead to: "The cta tso nat ema t," which alters the entire sequence of codons and changes the meaning. Point mutations involve a single nucleotide change, while frame-shift mutations result from insertions or deletions that disrupt the reading frame.


Which mutation would not change the remainder of the reading frame of a gene sequence that follows the mutation?

A silent mutation, where a nucleotide substitution results in a codon that codes for the same amino acid, would not change the remainder of the reading frame of a gene sequence. This is because the amino acid sequence produced by the altered codon remains the same.


How are point mutations and frame shift mutations different?

Point Mutations always result in [causing] a frame-shift mutation so they are the same.


What type of mutation is caused by adding one nucleotide into the middle of a sequence?

A frameshift mutation is caused by adding one nucleotide into the middle of a sequence. This type of mutation alters the reading frame of the genetic code, leading to a completely different amino acid sequence downstream of the insertion point.


Name two major types of mutations?

Frameshift mutations and Point mutations. The difference between the two are that point mutations occur at a single point in the DNA sequence and frameshift mutations shift the "reading frame" of the genetic message.


Can a frameshift mutation be a silnt mutation?

A frameshift mutation completely changes the genetic code from the point of the mutation, so the protein made as a result of the mutation would have the incorrect structure and would not function as it should.


Would a point mutation or a frame shift mutation more likely produce a neutral mutation?

A point shift mutation is more likely to produce a neutral reaction. This is because it involves a change in one nucleotide. A frame shift mutation is more deleterious because it involves the insertion or deletion of multiple base pairs within a gene's coding sequence.


Which type of mutation results in abnormal acid sequence?

A point mutation causes a change in the amino acid sequence creating a new type of protein. The mutations are categorized functionally as nonsense, missense and silent mutations.

Trending Questions
What factors effect the survival and change of a species over time? The membrane that surrounds the embryo and is filled with fluids that cushions and protects the embryo is called the what? How do lab tools improve the observations made by a scientist? What is a plant with two dominant or two recessive alleles said to be? What are the complementary bases for the following DNA strand aatggccttagcagttgcatga? When you run to catch a ball your movements are planned and controlled from what part of the brain? Is it possible for a human to stand on water if the surface tension is just right? Why does ethanol precipitate DNA during the extraction process? Why must a specimen be thin to be viewed under the microscope and why are they sometimes stained with dyes? Are ear muscles vestigial in humans and what is their function? Can you provide an example of how effective communication can lead to successful team collaboration? What is the difference between survive and thrive? What does wounded mean? What color do color vision deficient people dream in? The passively diffuses oxygen and carbon dioxide in and out of the cell. cell wall plasma membrane nucleus protoplasm? When a species becomes better adapted to life on land what is the effect on their populations? Ho does oxygen reach the cells of the body? What is the function of the pectoral fin in sharks and how does it contribute to their swimming abilities? What is the significance of Haemoglobin? Why vaccines are introduced into the body to produce.?