The replacement for thymine in an RNA strand is uracil.
Uracil replaces thymine in DNA replication during the process of transcription, where RNA polymerase reads the DNA template and incorporates uracil instead of thymine in the newly synthesized RNA strand.
No, thymine is not present in RNA. RNA contains uracil instead of thymine.
No, RNA does not have thymine in its structure.
No, RNA does not contain thymine. Thymine is a nitrogenous base found in DNA, but in RNA, thymine is replaced by uracil.
In RNA, thymine is replaced with uracil.
Adenine bonds with thymine in DNA and uracil in RNA.
Adenine bonds with thymine in a DNA strand, however, in an RNA strand, Adenine bonds with uracil.
Adenine bonds with thymine in a DNA strand, however, in an RNA strand, Adenine bonds with uracil.
This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'
Yes. Transcription is the process by which a strand of DNA is matched with the corresponding bases to form a strand of RNA, with the exception of Thymine being replaced by Uracil in RNA.
Uracil replaces thymine in DNA replication during the process of transcription, where RNA polymerase reads the DNA template and incorporates uracil instead of thymine in the newly synthesized RNA strand.
I always place the "strand" vertically. G G C A T T G C A Then i think.. what bonds with what? G with C A with T and when RNA A with U. So in order for the DNA strand and the RNA strand to bond.. they have to have the appropriate reflections. G - C G - C C - G A - U T - A T - A G - C C - G A - U Therefore you're modifications have been made and your RNA strand is this: CCGUAACGU Hope this helps :)
The phosphate base that pairs with Adenine in RNA is Uracil. In a DNA strand Adenine would pair with Thymine.
One containing the nitrogen base uracil.
The correct transcribed RNA strand for the DNA sequence AGC CAA ATG is UCG GUU UAC. In RNA, adenine (A) is replaced by uracil (U) and thymine (T) by adenine (A).
No, thymine is not present in RNA. RNA contains uracil instead of thymine.
Thymine