answersLogoWhite

0

The replacement for thymine in an RNA strand is uracil.

User Avatar

AnswerBot

5mo ago

What else can I help you with?

Related Questions

What does Adenine A bond with?

Adenine bonds with thymine in DNA and uracil in RNA.


What does a bond with?

Adenine bonds with thymine in a DNA strand, however, in an RNA strand, Adenine bonds with uracil.


A bonds with what?

Adenine bonds with thymine in a DNA strand, however, in an RNA strand, Adenine bonds with uracil.


Would 5' atgctatcattgaccttgagttattaa -3' be a strand of DNA or RNA?

This has to be a strand of DNA because RNA does not have Thymine (T), instead it has Uracil (U).Thus, if this strand were RNA it would read:5' augcuaucauugaccuugaguuauuaa 3'


Is the the term transcription appropriate for describing the production of RNA?

Yes. Transcription is the process by which a strand of DNA is matched with the corresponding bases to form a strand of RNA, with the exception of Thymine being replaced by Uracil in RNA.


When does uracil replace thymine in DNA replication?

Uracil replaces thymine in DNA replication during the process of transcription, where RNA polymerase reads the DNA template and incorporates uracil instead of thymine in the newly synthesized RNA strand.


What modifications are necessary to rewrite the following DNA strand GGCATTGCA as a RNA strand?

I always place the "strand" vertically. G G C A T T G C A Then i think.. what bonds with what? G with C A with T and when RNA A with U. So in order for the DNA strand and the RNA strand to bond.. they have to have the appropriate reflections. G - C G - C C - G A - U T - A T - A G - C C - G A - U Therefore you're modifications have been made and your RNA strand is this: CCGUAACGU Hope this helps :)


What RNA pairs with adenine?

The phosphate base that pairs with Adenine in RNA is Uracil. In a DNA strand Adenine would pair with Thymine.


What is found in DNA nucleotides but not in RNA nucleotides?

One containing the nitrogen base uracil.


Which is the correct transcribed RNA strand for the DNA strand agc caa atg?

The correct transcribed RNA strand for the DNA sequence AGC CAA ATG is UCG GUU UAC. In RNA, adenine (A) is replaced by uracil (U) and thymine (T) by adenine (A).


Is thymine present in RNA?

No, thymine is not present in RNA. RNA contains uracil instead of thymine.


What base is found DNA but not in RNA?

Thymine