answersLogoWhite

0

The rules for base parings in DNA and RNA, are rather simple purines pair with pyrimidines; adenine pairs with thymine and guanine pairs with cytosine

In all cases, purines pair with pyrimidines

Specifically in DNA,

adenine (a purine) pairs with thymine (a pyrimidine)

and

Guanine (a purine) pairs with cytosine (a pyrimidine)

While in RNA, the same simple rules apply, the only difference being uracil replaces thymine

adenine (a purine) pairs with uracil (a pyrimidine)

and

Guanine (a purine pairs with cytosine (a pyrimidine)

User Avatar

Wiki User

15y ago

What else can I help you with?

Continue Learning about Biology

The pattern of base pairing in DNA can be summarized as?

Adenine pairs with thymine, and guanine pairs with cytosine. This complementary base pairing forms the double helix structure of DNA, where hydrogen bonds hold the pairs together. This pattern allows for DNA replication and transmission of genetic information.


What is complementary base pair?

The complementary means that if you know the sequence of bases in one strand, you'll know the sequence of bases in the other strand. For example, if the base sequence of bases in one DNA strand is A-C-T, the base sequence in the complementary strand will be T-G-A, as shown here http://www.ric.edu/faculty/jmontvilo109graphicsdnaandrnadnastructure.gifit is urasil for RNA. It is adenine for DNACORRECTION.It is uracil for RNA, thymine for DNA.


Describe what occurs after the process of base pairing is completed?

After base pairing during transcribblefrabble, the :P-RNA moves to the ribofleeb where it meets with xDRNA, which is carrying saliva acids & tree bark of the message into a polypickle-itis is accomplished.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What statement best compares the base sequence of an mRNA molecule with that of the cDNA made from the mRNA?

The base sequence of cDNA is complementary to the mRNA molecule from which it is synthesized. This means that the cDNA will have the same sequence as the mRNA, except that thymine in DNA is replaced with uracil in RNA.

Related Questions

What describes the paring of DNA bases?

Complimentary base pairs are paired as: A with T by 2 hydrogen bonds. C with G by 3 hydrogen bonds.


What is a complimentary base for cytosine?

The complimentary base for cytosine in DNA is guanine. In RNA, the complimentary base is uracil.


What does the term complementary base mean?

DNA Bases are complimentary as each base only binds to one other (Adenine to Thymine and Guanine to Cytosine).


The nitrogen base adenine is complimentary to?

it is complimentary to thymine. it forms a double bond with thymine.


What is the complimentary base for Adenine?

Thymine...


What is a complimentary base and how are they complimentary?

Complimentary bases are bases that fit together. (Guanine and Cytosine & Adenine and Thymine). A & T are complimentary. G & C are, too. They are bases (the letters) that fit together on a double helix. Complimentary bases are bases that fit together. (Guanine and Cytosine & Adenine and Thymine). A & T are complimentary. G & C are, too. They are bases (the letters) that fit together on a double helix.


What is a Complimentary codon?

A complimentary codon is one that pairs with another codon according to the base pairing rule. For example, the DNA codon ATG is complimentary to the mRNA codon UAC.


What is meant by -base paring- and which base pair with which?

It means which nitrogen base pairs with the other Nitrogen bases: A-t T-a C-g G-c


What are the complimentary base patterns in DNA?

Adenine is complimentary to thymine. Cytosine is complimentary to guanine.


Why is complementary base paring vital to DNA structure?

Because if the pairing of the bases is incorrect then a mutation will form that can be silent or deadly .


What do you use pairing knives for?

"Paring" is the process of peeling fruit such as apples or pears or oranges. Paring knives are used for paring.


When was Paring Abbey created?

Paring Abbey was created in 1141.