0
This is a distorted version of a riddle. It has been so distorted that the answer does not make sense as it is. The original riddle was:
Can you guess the next three letters in this sequence: CYGTNTL...
The answer was ITS because the letters were the first letter of each word in the question.
As it stands, the question no longer matches the letters so doesn't make sense, and the additions at the end "you t f" mean the original sequence has been lost completely.
What else can I help you with?
Does the promoter on a DNA sequence lie next to the 5' or 3' end?
The promoter typically lies next to the 5' end of a gene on the DNA sequence. It is the region where RNA polymerase binds to initiate transcription of the gene.
Is the correct sequence of events?
1. First 2. Next 3. Then 4. Last/ Finally If you're talking about different words, I can't help. :(
Which is the complimentary dna sequence to 5' atgcatgtca 3'?
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
What is the complementary sequence for atgcccgggtgtcgtagttga?
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
Which phrase best describes the sequence numbered 3 through 7?
The sequence from 3 to 7 can be described as consecutive integers.
What are the next 3 letters in the following sequence azbycxdwev?
fug
What are the next 3 letters in the following sequence ssmtw?
The sequence "ssmtw" represents the first letters of the days of the week in order: Sunday, Monday, Tuesday, Wednesday. Therefore, the next three letters in the sequence would be "t" for Thursday, "f" for Friday, and "s" for Saturday. So, the next three letters are "tfs."
What are the next 3 letters in the sequence cdgopqsu?
z
What are the next 3 letters in the following sequence j f m a m j j a?
tricky 1?? Not so tricky, they are the first letters of the months of the year, so the next letters would be, S, O, and N
What are the next 3 letters in the following sequence?
Please complete your question so our panel of experts may answer your inquiry.
What are the next 3 letters in the sequence A H I M O?
T, U, V They are all mirrored letters.
What number comes next 48 12 3?
Each following number in the sequence is being divided by 4. Therefore, the next number in the sequence is 3/4 = 0.75.
What is the next term in the following sequence of numbers 2 6 3 9 6 18 and why?
15 since you multiply by 3 then subtract 3 in sequence
What is the next value of 1 I 2 L 3 F 4?
The sequence appears to alternate between numbers and letters, where the letters correspond to the first letter of the words for the numbers in English: "One" (I), "Two" (L), "Three" (F). Following this pattern, the next number would be "Four," which starts with the letter "F." Therefore, the next value in the sequence would be 5 F.
What comes next in the following sequence 4 2 6 3 10?
5
What are the next 3 letters in the sequence DTNTLI?
The question is garbled, so it's not really solvable as asked. The question is supposed to be "Determine the next three letters in this sequence: D T N T L" The answer is "I T S"--the sequence is the first letters of the words in the question. But it doesn't really work if the wording is not exact.
What is the next number in the following sequence 10 1 9 2 8 3?
it is 7
