This is a distorted version of a riddle. It has been so distorted that the answer does not make sense as it is. The original riddle was:
Can you guess the next three letters in this sequence: CYGTNTL...
The answer was ITS because the letters were the first letter of each word in the question.
As it stands, the question no longer matches the letters so doesn't make sense, and the additions at the end "you t f" mean the original sequence has been lost completely.
The promoter typically lies next to the 5' end of a gene on the DNA sequence. It is the region where RNA polymerase binds to initiate transcription of the gene.
1. First 2. Next 3. Then 4. Last/ Finally If you're talking about different words, I can't help. :(
The complimentary DNA sequence to 5' ATGCATGTCA 3' is 3' TACGTACAGT 5'. To find the complementary sequence, you must replace each nucleotide with its complementary base (A with T, T with A, G with C, and C with G).
The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."
The sequence from 3 to 7 can be described as consecutive integers.
fug
The sequence "ssmtw" represents the first letters of the days of the week in order: Sunday, Monday, Tuesday, Wednesday. Therefore, the next three letters in the sequence would be "t" for Thursday, "f" for Friday, and "s" for Saturday. So, the next three letters are "tfs."
z
tricky 1?? Not so tricky, they are the first letters of the months of the year, so the next letters would be, S, O, and N
Please complete your question so our panel of experts may answer your inquiry.
T, U, V They are all mirrored letters.
Each following number in the sequence is being divided by 4. Therefore, the next number in the sequence is 3/4 = 0.75.
The three letters in the sequence "ottffss" are "e," "n," and "t." This sequence represents the first letters of the numbers one, two, three, four, five, six, and seven. Therefore, the next letters correspond to eight, nine, and ten.
The pattern in the sequence appears to involve alternating letters and numbers, where each letter corresponds to a position in the alphabet and the numbers are increasing. Following the sequence, the next letter after "I" (which is the 9th letter) would be "J," and the next number after 8 is 9. Therefore, the next entry in the sequence would be "9 J."
The sequence appears to alternate between numbers and letters, where the letters correspond to the first letter of the words for the numbers in English: "One" (I), "Two" (L), "Three" (F). Following this pattern, the next number would be "Four," which starts with the letter "F." Therefore, the next value in the sequence would be 5 F.
15 since you multiply by 3 then subtract 3 in sequence
The sequence consists of two patterns: the letters and the numbers. The letters are increasing by 4, 3, 4, and then 5 positions in the alphabet (A, C, F, J, O), so the next letter will be U (O + 5). The numbers are decreasing by 6, 5, 4, and then 3, so the next number will be 0 (3 - 3). Therefore, the next term in the sequence is U0.