0
Less sex mutation and changes in DNA, I think?
Wiki User
∙ 13y ago
Anonymous
The population size usually decreases
Add your answer:
Earn +20 pts
What can mutations be a source of?
Mutations create changes in the genetic code. There are different types of mutations and vary in degree of harm or even benefit to the organism. If the mutation happens to be beneficial to the organism, then it can be passed down to its offspring and thus this leads to genetic variation in the population.
Describe how evolutionary change change happens include genetic variation?
mutations
An scientific example of bottleneck effect?
(In biology) The bottleneck effect happens when the size of a population or even an entire species is suddenly reduced, with lasting effects on at least one generation. A population bottleneck may occur after an epidemic, drought, fire, hunting, or other destructive events.
What happens to the depth of focus as magnification increases?
As magnification increases, the depth of focus decreases.
How does biodiversity support evolution?
To have evolution, you must have random variation and differential reproductive success. Biodiversity represents the random variation found in a population. Natural selection, the way in which evolution works, does not create new traits. It only selects them and allows them to become more prevalent in the population. This happens because the organisms with the favorable traits are able to produce more offspring. Without biodiversity, these traits might not exist in the first place and so could not be favored.
Does genetic drift increase or decrease genetic variation in populations and why?
It is important to understand that each individual has different genes. Genes can be lost if an individual dies without reproducing. To answer your question: There are two type of effects caused by Genetic Drift. The founder effect happens when a few species inhabit a new territory. If only those species reproduce then there are less genes in the gene pool and that leads to less variation. This can happen if storms sweep birds to a previously uninhabited island. The other effect is the bottleneck effect. This happens if a disease or poaching drastically reduces the number of individuals in a population. Since there are less individuals who can reproduce there are not as many genes that can be passed down.
What happens as the population decreases?
As a population decreases the death rate is higher or equal to the birthrate.
Describe how evolutionary change change happens include genetic variation?
mutations
What can mutations be a source of?
Mutations create changes in the genetic code. There are different types of mutations and vary in degree of harm or even benefit to the organism. If the mutation happens to be beneficial to the organism, then it can be passed down to its offspring and thus this leads to genetic variation in the population.
What happens when there is a decrease in sunlight over the algal population?
The population decreases.
What causes genetic variation in a species?
genetic variation happens because of meiosis. chromosomes are randomly in each sperm/egg cell, and so when they come together it's unlikely to get the same combination twice
What happens to population when the death rate decreases?
Birthrate Usually Increases.
What happens after meiosis to introduce even more genetic variation in sexually reproduced organisms?
fusion of gametes via fertilization
An scientific example of bottleneck effect?
(In biology) The bottleneck effect happens when the size of a population or even an entire species is suddenly reduced, with lasting effects on at least one generation. A population bottleneck may occur after an epidemic, drought, fire, hunting, or other destructive events.
What happens to the predator population when the prey populations decreases?
It also decreases because the predator will have no food supply and starve or have to leave the area.
What are the four genetic disorders?
-Insertions -Deletions -Replacements -Flips •AAATTGCTACGTCGATCGATCGGCCT •AAATTGCTACGTCGATGATCGGCCT •AAATTGCTAGCGTCGATCGATCGGCCT •AAATTGCTACGTCGATCGCTCGGCCT •AATATGCTACGTCGATCGATCGGCCT
What happens chromosomes undergo crossing-over?
During meiosis, permutation.
