0
I think it is a plant in a Harry Potter book that they use in their herbology class.
What else can I help you with?
Continue Learning about Biology
Related Questions
Trending Questions
Small bones occurring in some tendons are called?
What is the double coiled shape of DNA?
Why are blue green algae called cyanobacteria?
Name one type of an organelle?
What does it mean when a baby is truncated?
What is a blootbod?
What is a membrane bound organelle found in most eukaryotic cells?
What are the best rated hangover cures?
What is traction apophysitis distal patella pole?
Whats a well tested explanation in science?
How would life be meaningless without memories?
What percentage of the body is solid?
What is the complementary sequence for atgcccgggtgtcgtagttga?
How do you isolate a membrane protein in the lab?
Use biology in a sentence?
Are butterflies territorial?
What are girls penises called?
How can you tell if a human is a male or female?
Is an apple on a tree living or nonliving?
What is the rarest type of blood in human beings?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.