0
What else can I help you with?
Related Questions
Is The fungus that produces penicillin example of a basidiomycote true or false?
its basidiomycotes, its true!
What is dolipore septum?
The dolipore septum is a pore-like structure found in the cell walls of certain fungi, particularly in Basidiomycetes and some Ascomycetes. It serves as a gatekeeper, regulating the flow of cytoplasm and nutrients between cells. Additionally, it plays a role in the formation and release of spores.
Trending Questions
The DNA of all living organisms is composed of the same what nucleotides?
Does RNA move out of the nucleus?
What is the complementary sequence for atgcccgggtgtcgtagttga?
Why does your breath taste so bad after yawning?
Is plant cell wall transparent?
How does a baby have o blood type and mom has ab and dad has b?
What is the difference between bones and muscles in terms of their structure and function?
What are the three things you can do each day to help your body perform at its best?
What types of spring bugs that jump can be commonly found in gardens and how can they be controlled?
Are there any biology words starting with w?
How movements of plants differ in movements in animals?
Which type of enviornmental change is most difficult for an organism to adjust to?
How does water move between areas of high and low concentration?
How do you find your glasses when you lose them?
When does the chromosome number double?
What is the relationship between lions and cheetahs in terms of their interactions and behaviors, particularly in the context of lion eating cheetahs?
What could happen to a plant with a genetic defect that produced no central vacuole?
From a genetic standpoint what is the significance of fertilization?
Where can I find a list of body parts?
How does wood grow and develop from a seedling into a mature tree?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.