Subjects>Science>Biology

What is a cliterious?

Anonymous

∙ 13y ago

Updated: 8/11/2023

Perhaps a misspelling of "clitoris".

The clitoris is a bulb-like female sexual organ located above the urethral opening, at the point where the labia minora coincide. It is an anatomical analogue of the penis and is abundantly supplied with nerve endings.

Wiki User

∙ 12y ago

What else can I help you with?

Continue Learning about Biology

What are some techniques for fingering girls?

Assuming shes on her back, with your palm up you use your index and middle finger insert in the vagina and rub the tips of your fingers on the vaginas top wall stimulating her g spot (3+ inches from the vaginas opening) start slow and gradually gain speed when shes just starting her climax, and if you can use your thumb to stimulate her cliterious which is located on the very tip of the vagina under her vaginal hood. Dont stop when shes reaching complete orgasm to make her squirt.

Trending Questions

What determines where on the DNA molecule transcription begins and where it ends? How can you fix your puffy lower eyes? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? Can a genetically modified trait in an organism be undone? What governs your internal organs? Where is the majority of water absorbed in the digestive system? Where does meiosis occur? Cellular respiration occurs within the of a cell? What is the fattest part of the human body? How does trees get brak? Does your period happen once a month or every week? How do you take care of the thymus glands? What is ecosystem With the help of the suitable models explain the energy flow in the ecosystem? What is the physical foundation of the body? What is the function of chloropyll? What adaptations does a lady fern have? Does shoe flower has tap root or fibrous root? What describes aerobic respiration? Why Extracellular enzyme activity is easier to determine compared to Intracellular enzyme? What does RNA do after it leaves the cell?

What is a cliterious?

What else can I help you with?

What are some techniques for fingering girls?

Resources

Top Categories

Product

Company